View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-14 (Length: 396)

Name: F9119J-LTR4-TNT-insertion-14
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-14
F9119J-LTR4-TNT-insertion-14
[»] chr1 (1 HSPs)
chr1 (9-386)||(6412926-6413303)
[»] chr3 (1 HSPs)
chr3 (101-258)||(30780091-30780249)


Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 9 - 386
Target Start/End: Complemental strand, 6413303 - 6412926
Alignment:
9 catgaaccaaatgaatcgaacttgagttgaaagtaaactcctacaagtatttacaataacaccaacttctgaattgtgagcaaatttagtcgaaatgtcg 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6413303 catgaaccaaatgaatcgaacttgagttgaaagtaaactcctacaagtatttacaataacaccaacttctgaattgtgagcaaatttagtcgaaatgtcg 6413204  T
109 tctacaactagcttgctatctagttctaactccactcgagtaaaactgaaattcaaacgccacaaaagcacttgacgtaggcctatacttccactccttg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6413203 tctacaactagcttgctatctagttctaactccactcgagtaaaactgaaattcaaacgccacaaaagcacttgacgtaggcctatacttccactccttg 6413104  T
209 aggtgttggttggccttttttcacactatttgagcacaaatgaattcaccnnnnnnncgttcctaacacacatacaaacaattttatctgtaaagattgc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||    
6413103 aggtgttggttggccttttttcacactatttgagcacaaatgaattcacctttttttcgttcctaacacacatacaaacaattttatctgtaaagattgc 6413004  T
309 ttgaacctggttacacttgacttcacctgtcatcggaaactgtccaactatgttaactcatacccgctactttgatta 386  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6413003 ttgaacctggttacacttgacttcacctgtcatcggaaactgtccaactatgttaactcatacccgctactttgatta 6412926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 101 - 258
Target Start/End: Original strand, 30780091 - 30780249
Alignment:
101 aaatgtcgtctacaactagcttgctatctagttctaactccactcgagtaaaactgaaattcaaacgccacaaaagcacttgacgtaggcc-tatacttc 199  Q
    |||| ||||| || |||||||||||||||||||||| | |||| ||||||||||   |||||| |  |||||||||  ||||   ||||||  || |||     
30780091 aaatatcgtccaccactagcttgctatctagttctatcgccacacgagtaaaacctgaattcataaaccacaaaagtgcttgctttaggccacatgcttt 30780190  T
200 cactccttgaggtgttggttggccttttttcacactatttgagcacaaatgaattcacc 258  Q
    | || |||||| ||| ||||| || ||||||| | | ||||||||||||| ||||||||    
30780191 cgcttcttgagatgtcggttgaccatttttcatattgtttgagcacaaataaattcacc 30780249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 84162 times since January 2019
Visitors: 2323