View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-14 (Length: 396)

Name: F9119J-LTR4-TNT-insertion-14
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9119J-LTR4-TNT-insertion-14
[»] chr1 (1 HSPs)
chr1 (9-386)||(6412926-6413303)
[»] chr3 (1 HSPs)
chr3 (101-258)||(30780091-30780249)

Alignment Details
Target: chr1 (Bit Score: 357; Significance: 0; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 357; E-Value: 0
Query Start/End: Original strand, 9 - 386
Target Start/End: Complemental strand, 6413303 - 6412926
9 catgaaccaaatgaatcgaacttgagttgaaagtaaactcctacaagtatttacaataacaccaacttctgaattgtgagcaaatttagtcgaaatgtcg 108  Q
6413303 catgaaccaaatgaatcgaacttgagttgaaagtaaactcctacaagtatttacaataacaccaacttctgaattgtgagcaaatttagtcgaaatgtcg 6413204  T
109 tctacaactagcttgctatctagttctaactccactcgagtaaaactgaaattcaaacgccacaaaagcacttgacgtaggcctatacttccactccttg 208  Q
6413203 tctacaactagcttgctatctagttctaactccactcgagtaaaactgaaattcaaacgccacaaaagcacttgacgtaggcctatacttccactccttg 6413104  T
209 aggtgttggttggccttttttcacactatttgagcacaaatgaattcaccnnnnnnncgttcctaacacacatacaaacaattttatctgtaaagattgc 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||    
6413103 aggtgttggttggccttttttcacactatttgagcacaaatgaattcacctttttttcgttcctaacacacatacaaacaattttatctgtaaagattgc 6413004  T
309 ttgaacctggttacacttgacttcacctgtcatcggaaactgtccaactatgttaactcatacccgctactttgatta 386  Q
6413003 ttgaacctggttacacttgacttcacctgtcatcggaaactgtccaactatgttaactcatacccgctactttgatta 6412926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 101 - 258
Target Start/End: Original strand, 30780091 - 30780249
101 aaatgtcgtctacaactagcttgctatctagttctaactccactcgagtaaaactgaaattcaaacgccacaaaagcacttgacgtaggcc-tatacttc 199  Q
    |||| ||||| || |||||||||||||||||||||| | |||| ||||||||||   |||||| |  |||||||||  ||||   ||||||  || |||     
30780091 aaatatcgtccaccactagcttgctatctagttctatcgccacacgagtaaaacctgaattcataaaccacaaaagtgcttgctttaggccacatgcttt 30780190  T
200 cactccttgaggtgttggttggccttttttcacactatttgagcacaaatgaattcacc 258  Q
    | || |||||| ||| ||||| || ||||||| | | ||||||||||||| ||||||||    
30780191 cgcttcttgagatgtcggttgaccatttttcatattgtttgagcacaaataaattcacc 30780249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC