View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-3 (Length: 471)

Name: F9119J-LTR4-TNT-insertion-3
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-3
F9119J-LTR4-TNT-insertion-3
[»] chr5 (1 HSPs)
chr5 (10-464)||(10122817-10123271)
[»] chr8 (3 HSPs)
chr8 (39-168)||(30626574-30626703)
chr8 (96-168)||(2469143-2469215)
chr8 (347-412)||(30626141-30626206)


Alignment Details
Target: chr5 (Bit Score: 451; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 451; E-Value: 0
Query Start/End: Original strand, 10 - 464
Target Start/End: Original strand, 10122817 - 10123271
Alignment:
10 tggtctccagcagcagccggaaacatgaagttcaatattctatcaggaacttctacgtcttgtcctcatgtaactggcattgcagccttaatcaaagctg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
10122817 tggtctccagcagcagccggaaacatgaagttcaatattctatcaggaacttctatgtcttgtcctcatgtaactggcattgcagccttaatcaaagctg 10122916  T
110 tacatccttcatggtctccatctgctatcaaatctgccatcatgactactggtattacacattatctagaacttgtattactcattgtggtttatttgag 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10122917 tacatccttcatggtctccatctgctatcaaatctgccatcatgactactggtattacacattatctagaacttgtattactcattgtggtttatttgag 10123016  T
210 attcttcacaatcagacatccaagtaaagctccctaatagattagatttaatctaaaggaactaatcatataattcaatatgcagcaacgattgtggata 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10123017 attcttcacaatcagacatccaagtaaagctccctaatagattagatttaatctaaaggaactaatcatataattcaatatgcagcaacgattgtggata 10123116  T
310 agaaaaacgaaccaattagagcggatcctgatagaagaagggctgatgcatttgattatggatcagggtttgtgaatcctgcaggagctctggatcctgg 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10123117 agaaaaacgaaccaattagagcggatcctgatagaagaagggctgatgcatttgattatggatcagggtttgtgaatcctgcaggagctctggatcctgg 10123216  T
410 tcttgtatatgattcacagtcggaagattttgttgcattcctgtgttcaattggt 464  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10123217 tcttgtatatgattcacagtcggaagattttgttgcattcctgtgttcaattggt 10123271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 82; Significance: 2e-38; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 39 - 168
Target Start/End: Complemental strand, 30626703 - 30626574
Alignment:
39 gttcaatattctatcaggaacttctacgtcttgtcctcatgtaactggcattgcagccttaatcaaagctgtacatccttcatggtctccatctgctatc 138  Q
    |||||| ||||| ||||||||||| | | ||||||||||||||||||| |||||| ||||| |||||||||| |||||||||||||||||||||||||||    
30626703 gttcaacattctgtcaggaacttccatggcttgtcctcatgtaactggaattgcaaccttagtcaaagctgttcatccttcatggtctccatctgctatc 30626604  T
139 aaatctgccatcatgactactggtattaca 168  Q
    || || ||||||||||| ||||||||||||    
30626603 aagtcggccatcatgacaactggtattaca 30626574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 96 - 168
Target Start/End: Original strand, 2469143 - 2469215
Alignment:
96 cttaatcaaagctgtacatccttcatggtctccatctgctatcaaatctgccatcatgactactggtattaca 168  Q
    |||| |||||||||| |||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||    
2469143 cttagtcaaagctgtccatccttcatggtctccatctgatatcaaatctgtcatcatgacaactggtattaca 2469215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 412
Target Start/End: Complemental strand, 30626206 - 30626141
Alignment:
347 aagggctgatgcatttgattatggatcagggtttgtgaatcctgcaggagctctggatcctggtct 412  Q
    ||||||| |||||||||||||||||||||||||| |||| |||||| ||| ||| |||||||||||    
30626206 aagggctaatgcatttgattatggatcagggtttttgaaccctgcaagagttcttgatcctggtct 30626141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 95133 times since January 2019
Visitors: 2229