View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-3 (Length: 471)

Name: F9119J-LTR4-TNT-insertion-3
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9119J-LTR4-TNT-insertion-3
[»] chr5 (1 HSPs)
chr5 (10-464)||(10122817-10123271)
[»] chr8 (3 HSPs)
chr8 (39-168)||(30626574-30626703)
chr8 (96-168)||(2469143-2469215)
chr8 (347-412)||(30626141-30626206)

Alignment Details
Target: chr5 (Bit Score: 451; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 451; E-Value: 0
Query Start/End: Original strand, 10 - 464
Target Start/End: Original strand, 10122817 - 10123271
10 tggtctccagcagcagccggaaacatgaagttcaatattctatcaggaacttctacgtcttgtcctcatgtaactggcattgcagccttaatcaaagctg 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
10122817 tggtctccagcagcagccggaaacatgaagttcaatattctatcaggaacttctatgtcttgtcctcatgtaactggcattgcagccttaatcaaagctg 10122916  T
110 tacatccttcatggtctccatctgctatcaaatctgccatcatgactactggtattacacattatctagaacttgtattactcattgtggtttatttgag 209  Q
10122917 tacatccttcatggtctccatctgctatcaaatctgccatcatgactactggtattacacattatctagaacttgtattactcattgtggtttatttgag 10123016  T
210 attcttcacaatcagacatccaagtaaagctccctaatagattagatttaatctaaaggaactaatcatataattcaatatgcagcaacgattgtggata 309  Q
10123017 attcttcacaatcagacatccaagtaaagctccctaatagattagatttaatctaaaggaactaatcatataattcaatatgcagcaacgattgtggata 10123116  T
310 agaaaaacgaaccaattagagcggatcctgatagaagaagggctgatgcatttgattatggatcagggtttgtgaatcctgcaggagctctggatcctgg 409  Q
10123117 agaaaaacgaaccaattagagcggatcctgatagaagaagggctgatgcatttgattatggatcagggtttgtgaatcctgcaggagctctggatcctgg 10123216  T
410 tcttgtatatgattcacagtcggaagattttgttgcattcctgtgttcaattggt 464  Q
10123217 tcttgtatatgattcacagtcggaagattttgttgcattcctgtgttcaattggt 10123271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 82; Significance: 2e-38; HSPs: 3)
Name: chr8

Target: chr8; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 39 - 168
Target Start/End: Complemental strand, 30626703 - 30626574
39 gttcaatattctatcaggaacttctacgtcttgtcctcatgtaactggcattgcagccttaatcaaagctgtacatccttcatggtctccatctgctatc 138  Q
    |||||| ||||| ||||||||||| | | ||||||||||||||||||| |||||| ||||| |||||||||| |||||||||||||||||||||||||||    
30626703 gttcaacattctgtcaggaacttccatggcttgtcctcatgtaactggaattgcaaccttagtcaaagctgttcatccttcatggtctccatctgctatc 30626604  T
139 aaatctgccatcatgactactggtattaca 168  Q
    || || ||||||||||| ||||||||||||    
30626603 aagtcggccatcatgacaactggtattaca 30626574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 96 - 168
Target Start/End: Original strand, 2469143 - 2469215
96 cttaatcaaagctgtacatccttcatggtctccatctgctatcaaatctgccatcatgactactggtattaca 168  Q
    |||| |||||||||| |||||||||||||||||||||| ||||||||||| ||||||||| ||||||||||||    
2469143 cttagtcaaagctgtccatccttcatggtctccatctgatatcaaatctgtcatcatgacaactggtattaca 2469215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 347 - 412
Target Start/End: Complemental strand, 30626206 - 30626141
347 aagggctgatgcatttgattatggatcagggtttgtgaatcctgcaggagctctggatcctggtct 412  Q
    ||||||| |||||||||||||||||||||||||| |||| |||||| ||| ||| |||||||||||    
30626206 aagggctaatgcatttgattatggatcagggtttttgaaccctgcaagagttcttgatcctggtct 30626141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC