View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-5 (Length: 465)

Name: F9119J-LTR4-TNT-insertion-5
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-5
F9119J-LTR4-TNT-insertion-5
[»] chr2 (1 HSPs)
chr2 (7-455)||(44011144-44011592)
[»] chr4 (1 HSPs)
chr4 (284-393)||(3175753-3175862)
[»] chr7 (1 HSPs)
chr7 (355-455)||(22377006-22377104)
[»] chr3 (1 HSPs)
chr3 (355-455)||(30733921-30734019)


Alignment Details
Target: chr2 (Bit Score: 449; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 449; E-Value: 0
Query Start/End: Original strand, 7 - 455
Target Start/End: Original strand, 44011144 - 44011592
Alignment:
7 aacaacatcatgctatatttaagtacaaaatctagatcagttctttgtgcactgtttttactgttatctaattacaattcaacacatggaccgtgtatgt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44011144 aacaacatcatgctatatttaagtacaaaatctagatcagttctttgtgcactgtttttactgttatctaattacaattcaacacatggaccgtgtatgt 44011243  T
107 aatagtataaactgaatcggtttaagtttaaatttaattgaaaaatttaaaccgcgtgacaaattataattggggaacaacacggatagtatccattgag 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44011244 aatagtataaactgaatcggtttaagtttaaatttaattgaaaaatttaaaccgcgtgacaaattataattggggaacaacacggatagtatccattgag 44011343  T
207 taggacctaagttttgtattatttttaagtatgtaacatgtaatatgtgacagaaaagtgtagcaagttttgattctgcttactgtgagagataggattc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44011344 taggacctaagttttgtattatttttaagtatgtaacatgtaatatgtgacagaaaagtgtagcaagttttgattctgcttactgtgagagataggattc 44011443  T
307 ctgtgacaatgcctgttttgatagcaagagccaagtaaggaccattgaagtataacaggtttactgatggtggattaactccctttgctaagtgcccaat 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44011444 ctgtgacaatgcctgttttgatagcaagagccaagtaaggaccattgaagtataacaggtttactgatggtggattaactccctttgctaagtgcccaat 44011543  T
407 ctgcagcaaaatacacagagaatcagtcagttattactacttttgatta 455  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
44011544 ctgcagcaaaatacacagagaatcagtcagttattactacttttgatta 44011592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 284 - 393
Target Start/End: Complemental strand, 3175862 - 3175753
Alignment:
284 gcttactgtgagagataggattcctgtgacaatgcctgttttgatagcaagagccaagtaaggaccattgaagtataacaggtttactgatggtggatta 383  Q
    |||||| |||||||| | |||||| |||||||  || |||||||||||||||||||| |  |||||| |||||||||||| ||||  |||||||||||||    
3175862 gcttacagtgagagacaagattccagtgacaagtccagttttgatagcaagagccaaatgtggaccactgaagtataacatgtttgatgatggtggatta 3175763  T
384 actccctttg 393  Q
    | ||||||||    
3175762 agtccctttg 3175753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 355 - 455
Target Start/End: Original strand, 22377006 - 22377104
Alignment:
355 agtataacaggtttactgatggtggattaactccctttgctaagtgcccaatctgcagcaaaatacacagagaatcagtcagttattactacttttgatt 454  Q
    ||||||||| |||||| |||||||||||||||| ||||| |||||| || |||||||  |||||||||  | ||||| ||| |||||||| |||||||||    
22377006 agtataacatgtttaccgatggtggattaactcactttgttaagtggccgatctgcaagaaaatacac--ataatcaatcaattattactgcttttgatt 22377103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 355 - 455
Target Start/End: Complemental strand, 30734019 - 30733921
Alignment:
355 agtataacaggtttactgatggtggattaactccctttgctaagtgcccaatctgcagcaaaatacacagagaatcagtcagttattactacttttgatt 454  Q
    ||||||||| |||||| |||||||||||||||| ||||| |||||| || |||||||  |||||||||  | ||||| ||| |||||||| |||||||||    
30734019 agtataacatgtttaccgatggtggattaactcactttgttaagtggccgatctgcaagaaaatacac--ataatcaatcaattattactgcttttgatt 30733922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98537 times since January 2019
Visitors: 2275