View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-5 (Length: 465)

Name: F9119J-LTR4-TNT-insertion-5
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9119J-LTR4-TNT-insertion-5
[»] chr2 (1 HSPs)
chr2 (7-455)||(44011144-44011592)
[»] chr4 (1 HSPs)
chr4 (284-393)||(3175753-3175862)
[»] chr7 (1 HSPs)
chr7 (355-455)||(22377006-22377104)
[»] chr3 (1 HSPs)
chr3 (355-455)||(30733921-30734019)

Alignment Details
Target: chr2 (Bit Score: 449; Significance: 0; HSPs: 1)
Name: chr2

Target: chr2; HSP #1
Raw Score: 449; E-Value: 0
Query Start/End: Original strand, 7 - 455
Target Start/End: Original strand, 44011144 - 44011592
7 aacaacatcatgctatatttaagtacaaaatctagatcagttctttgtgcactgtttttactgttatctaattacaattcaacacatggaccgtgtatgt 106  Q
44011144 aacaacatcatgctatatttaagtacaaaatctagatcagttctttgtgcactgtttttactgttatctaattacaattcaacacatggaccgtgtatgt 44011243  T
107 aatagtataaactgaatcggtttaagtttaaatttaattgaaaaatttaaaccgcgtgacaaattataattggggaacaacacggatagtatccattgag 206  Q
44011244 aatagtataaactgaatcggtttaagtttaaatttaattgaaaaatttaaaccgcgtgacaaattataattggggaacaacacggatagtatccattgag 44011343  T
207 taggacctaagttttgtattatttttaagtatgtaacatgtaatatgtgacagaaaagtgtagcaagttttgattctgcttactgtgagagataggattc 306  Q
44011344 taggacctaagttttgtattatttttaagtatgtaacatgtaatatgtgacagaaaagtgtagcaagttttgattctgcttactgtgagagataggattc 44011443  T
307 ctgtgacaatgcctgttttgatagcaagagccaagtaaggaccattgaagtataacaggtttactgatggtggattaactccctttgctaagtgcccaat 406  Q
44011444 ctgtgacaatgcctgttttgatagcaagagccaagtaaggaccattgaagtataacaggtttactgatggtggattaactccctttgctaagtgcccaat 44011543  T
407 ctgcagcaaaatacacagagaatcagtcagttattactacttttgatta 455  Q
44011544 ctgcagcaaaatacacagagaatcagtcagttattactacttttgatta 44011592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 284 - 393
Target Start/End: Complemental strand, 3175862 - 3175753
284 gcttactgtgagagataggattcctgtgacaatgcctgttttgatagcaagagccaagtaaggaccattgaagtataacaggtttactgatggtggatta 383  Q
    |||||| |||||||| | |||||| |||||||  || |||||||||||||||||||| |  |||||| |||||||||||| ||||  |||||||||||||    
3175862 gcttacagtgagagacaagattccagtgacaagtccagttttgatagcaagagccaaatgtggaccactgaagtataacatgtttgatgatggtggatta 3175763  T
384 actccctttg 393  Q
    | ||||||||    
3175762 agtccctttg 3175753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 355 - 455
Target Start/End: Original strand, 22377006 - 22377104
355 agtataacaggtttactgatggtggattaactccctttgctaagtgcccaatctgcagcaaaatacacagagaatcagtcagttattactacttttgatt 454  Q
    ||||||||| |||||| |||||||||||||||| ||||| |||||| || |||||||  |||||||||  | ||||| ||| |||||||| |||||||||    
22377006 agtataacatgtttaccgatggtggattaactcactttgttaagtggccgatctgcaagaaaatacac--ataatcaatcaattattactgcttttgatt 22377103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 355 - 455
Target Start/End: Complemental strand, 30734019 - 30733921
355 agtataacaggtttactgatggtggattaactccctttgctaagtgcccaatctgcagcaaaatacacagagaatcagtcagttattactacttttgatt 454  Q
    ||||||||| |||||| |||||||||||||||| ||||| |||||| || |||||||  |||||||||  | ||||| ||| |||||||| |||||||||    
30734019 agtataacatgtttaccgatggtggattaactcactttgttaagtggccgatctgcaagaaaatacac--ataatcaatcaattattactgcttttgatt 30733922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC