View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-6 (Length: 582)

Name: F9119J-LTR4-TNT-insertion-6
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-6
F9119J-LTR4-TNT-insertion-6
[»] chr8 (3 HSPs)
chr8 (9-572)||(27065459-27066022)
chr8 (23-552)||(27079196-27079725)
chr8 (51-549)||(27053040-27053538)
[»] chr5 (2 HSPs)
chr5 (308-516)||(14866315-14866523)
chr5 (29-150)||(14866036-14866157)
[»] chr4 (1 HSPs)
chr4 (308-516)||(55980222-55980433)


Alignment Details
Target: chr8 (Bit Score: 564; Significance: 0; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 564; E-Value: 0
Query Start/End: Original strand, 9 - 572
Target Start/End: Complemental strand, 27066022 - 27065459
Alignment:
9 caactaactctctcagtgatagtggtagtttggcaaaaaacatggttcaacctggtaagtttttccgggagaagatgttgaaggaagggacagttatgcc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27066022 caactaactctctcagtgatagtggtagtttggcaaaaaacatggttcaacctggtaagtttttccgggagaagatgttgaaggaagggacagttatgcc 27065923  T
109 tatgccagatataagggataaattaccgccaaggtcgtttttgcctcgttccattttgaccaaattgccatttgcatcttctaagttgaatgagatgaag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27065922 tatgccagatataagggataaattaccgccaaggtcgtttttgcctcgttccattttgaccaaattgccatttgcatcttctaagttgaatgagatgaag 27065823  T
209 caagttttcaaggtgtccgagaattcttcgatgaataagatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaaacgaagcgtt 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27065822 caagttttcaaggtgtccgagaattcttcgatgaataagatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaaacgaagcgtt 27065723  T
309 gtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcggtccactgagaatgtaaatggggcgggcaagga 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27065722 gtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcggtccactgagaatgtaaatggggcgggcaagga 27065623  T
409 tgtcatggtgggtaaagttaaggggataaatggtggaaaagttactgaatctgtatcgtgtcaccagagtttgtttccttatttgttatactactgtcac 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27065622 tgtcatggtgggtaaagttaaggggataaatggtggaaaagttactgaatctgtatcgtgtcaccagagtttgtttccttatttgttatactactgtcac 27065523  T
509 tcggttccaaatgttcatgtctatgaagcggatctattggatccagtttctaaggcaaagatta 572  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27065522 tcggttccaaatgttcatgtctatgaagcggatctattggatccagtttctaaggcaaagatta 27065459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 23 - 552
Target Start/End: Complemental strand, 27079725 - 27079196
Alignment:
23 agtgatagtggtagtttggcaaaaaacatggttcaacctggtaagtttttccgggagaagatgttgaaggaagggacagttatgcctatgccagatataa 122  Q
    ||||| |||| |||||||||||||||   |||||||||||||||||||||||| || |||||||||||  |||||   |||||||||||||| ||||| |    
27079725 agtgaaagtgttagtttggcaaaaaaatgggttcaacctggtaagtttttccgagaaaagatgttgaaacaaggggtggttatgcctatgccggatatta 27079626  T
123 gggataaattaccgccaaggtcgtttttgcctcgttccattttgaccaaattgccatttgcatcttctaagttgaatgagatgaagcaagttttcaaggt 222  Q
     ||||||||||||||||||||||||||| || ||| |||||||||||||||| || |||||||||||||||||||||||| ||||||||||||| |||||    
27079625 aggataaattaccgccaaggtcgtttttaccacgtaccattttgaccaaattaccctttgcatcttctaagttgaatgagttgaagcaagtttttaaggt 27079526  T
223 gtccgagaattcttcgatgaataagatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaaacgaagcgttgtgtgggttctctt 322  Q
    ||| |||||||| |||||| |||||||||| |||||  | ||| ||||||| |||||||| |||||| | ||||| || ||||||||||| ||||| |||    
27079525 gtctgagaattcctcgatggataagatgatagtggactcattgggtgagtgtgagagggcaccgagtatgggtgagacaaagcgttgtgttggttcactt 27079426  T
323 gaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcggtccactgagaatgtaaatggggcgggcaaggatgtcatggtgggta 422  Q
    |||||||||||||| ||||||||||| |||||||| ||   ||| |||||||| || ||||||| |||||||||  |||||||  |||||||||| || |    
27079425 gaggatatgattgactttgcaacttcagttttgggccatgatgtaactgttcgatcaactgagagtgtaaatggatcgggcaaaaatgtcatggttggaa 27079326  T
423 aagttaaggggataaatggtggaaaagttactgaatctgtatcgtgtcaccagagtttgtttccttatttgttatactactgtcactcggttccaaatgt 522  Q
      ||||| ||||| ||||| || ||||||||||||||||| || |||||||| |||||||||||||||||| ||||||| || |||||||||||||| ||    
27079325 gggttaaagggatcaatgggggtaaagttactgaatctgtgtcatgtcaccaaagtttgtttccttatttgctatactattgccactcggttccaaaggt 27079226  T
523 tcatgtctatgaagcggatctattggatcc 552  Q
    || ||| |||||||| ||||| || |||||    
27079225 tcgtgtttatgaagcagatcttttagatcc 27079196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 51 - 549
Target Start/End: Complemental strand, 27053538 - 27053040
Alignment:
51 tggttcaacctggtaagtttttccgggagaagatgttgaaggaagggacagttatgcctatgccagatataagggataaattaccgccaaggtcgttttt 150  Q
    ||||| |||| |||||||||||||| || | |||||||||||||||||| ||||||||||||||||||| ||||||||| ||||| || |||||||||||    
27053538 tggttgaaccaggtaagtttttccgcgaaaggatgttgaaggaagggactgttatgcctatgccagatacaagggataagttaccacctaggtcgttttt 27053439  T
151 gcctcgttccattttgaccaaattgccatttgcatcttctaagttgaatgagatgaagcaagttttcaaggtgtccgagaattcttcgatgaataagatg 250  Q
    ||| ||||||||||||| ||||||||| ||||||||||||||||||||  | ||||||||||||||||||||||| || ||||| |  ||| | ||||||    
27053438 gccacgttccattttgatcaaattgccctttgcatcttctaagttgaacaatatgaagcaagttttcaaggtgtctgaaaattcctttatggaaaagatg 27053339  T
251 atggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaaacgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctg 350  Q
    || |||||  | ||||||||||| || || ||||| |||  |||||| |  ||||||||||| ||||| |||||||| |||||||| ||||||||||||     
27053338 atagtggactcattgagtgagtgtgaaagagcgccaagtaaaggtgagatcaagcgttgtgtaggttcgcttgaggacatgattgactttgcaacttcta 27053239  T
351 ttttgggtcacagtgttactgttcggtccactgagaatgtaaatggggcgggcaaggatgtcatggtgggtaaagttaaggggataaatggtggaaaagt 450  Q
    ||||||||  || ||| || ||||||||||||||||||||||||||| ||  |||  |||| ||||| ||| |||| |||| |||||||||||| || ||    
27053238 ttttgggtagcaatgtgacggttcggtccactgagaatgtaaatgggtcgaacaacaatgttatggtaggtcaagtaaaggagataaatggtgggaacgt 27053139  T
451 tactgaatctgtatcgtgtcaccagagtttgtttccttatttgttatactactgtcactcggttccaaatgttcatgtctatgaagcggatctattgga 549  Q
    ||  || || || || ||||| || |||||||||||||| ||| |||| |||||||| ||||| |||||| |||   | ||||||||| |||| |||||    
27053138 tatggagtcagtgtcttgtcatcaaagtttgtttccttacttgctatattactgtcattcggtgccaaatattcgaatttatgaagcgaatcttttgga 27053040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 53; Significance: 4e-21; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 308 - 516
Target Start/End: Original strand, 14866315 - 14866523
Alignment:
308 tgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcggtccactgagaatgtaaatggggcgggcaagg 407  Q
    ||||| || ||| ||||||||||||| || ||||||||||| ||||||||||  | |||    |||||| | |||||||||||||||||| ||   ||||    
14866315 tgtgttgggtctattgaggatatgatcgactttgcaacttcggttttgggtcgaaatgtggtggttcggactactgagaatgtaaatgggtcgaagaagg 14866414  T
408 atgtcatggtgggtaaagttaaggggataaatggtggaaaagttactgaatctgtatcgtgtcaccagagtttgtttccttatttgttatactactgtca 507  Q
    |||| |||||||||   ||||| ||||| ||||| || ||||| ||    ||||| |||||||| |||||||||||||| |||||| | || || |||||    
14866415 atgttatggtgggtcgggttaatgggattaatggcgggaaagtgacccggtctgtttcgtgtcatcagagtttgtttccgtatttgctttattattgtca 14866514  T
508 ctcggttcc 516  Q
    |||||||||    
14866515 ctcggttcc 14866523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 29 - 150
Target Start/End: Original strand, 14866036 - 14866157
Alignment:
29 agtggtagtttggcaaaaaacatggttcaacctggtaagtttttccgggagaagatgttgaaggaagggacagttatgcctatgccagatataagggata 128  Q
    ||||||||||||| ||||||   |||| | ||||||||||||||  | ||||| |||||||| ||||| || || ||||||||||| ||||| || ||||    
14866036 agtggtagtttggtaaaaaaatgggttgagcctggtaagttttttagagagaaaatgttgaaagaaggtacggtaatgcctatgcctgatattagagata 14866135  T
129 aattaccgccaaggtcgttttt 150  Q
    |||||||   ||||||||||||    
14866136 aattacctaaaaggtcgttttt 14866157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 308 - 516
Target Start/End: Original strand, 55980222 - 55980433
Alignment:
308 tgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcggtccactgagaatgtaaatggggcgggcaagg 407  Q
    |||||||| ||| ||||||||||||| || |||||| |||| ||||||||||  | ||||   |||||| | |||||||||||||||||| ||   ||||    
55980222 tgtgtggggtctattgaggatatgatcgactttgcagcttcggttttgggtcgaaatgttgtggttcggactactgagaatgtaaatgggtcgaagaagg 55980321  T
408 atgtcatggtgggtaaagttaaggggat---aaatggtggaaaagttactgaatctgtatcgtgtcaccagagtttgtttccttatttgttatactactg 504  Q
    || | ||||||||| | ||||  |||||    |||||||||||| | ||   | |||| |||||||| ||||| |||||||  |||||| | || || ||    
55980322 atcttatggtgggtcatgttagtgggattaataatggtggaaaaatgacccgaactgtttcgtgtcatcagagcttgtttcagtatttgctttattattg 55980421  T
505 tcactcggttcc 516  Q
    ||||||||||||    
55980422 tcactcggttcc 55980433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93635 times since January 2019
Visitors: 2365