View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-7 (Length: 299)

Name: F9119J-LTR4-TNT-insertion-7
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-7
F9119J-LTR4-TNT-insertion-7
[»] chr2 (1 HSPs)
chr2 (8-291)||(3440428-3440711)


Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 8 - 291
Target Start/End: Complemental strand, 3440711 - 3440428
Alignment:
8 ggattgaggtatcaaagttggttaacgcctcactatcgctgccgattgaaccgtggtcactcaccagtcctaaaattttgcctaacaagtcgcaattctt 107  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3440711 ggattgaggtatcaaagttggttaacgcttcactatcgctgccgattgaaccgtggtcactcaccagtcctaaaattttgcctaacaagtcgcaattctt 3440612  T
108 agctaaagctgggacttgactactaactctaggactaggtggagggtacaatctagccccagagtaaaagtttggaatagaatttgaaaggccttgaagg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3440611 agctaaagctgggacttgactactaactctaggactaggtggagggtacaatctagccccagagtaaaagtttggaatagaatttgaaaggccttgaagg 3440512  T
208 gaccctaatagcttcagaaaaaccgacattgcaaaaaatgttgcacatcttgttgtgtccattttcttagttgttgtcacatta 291  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3440511 gaccctaatagcttcagaaaaaccaacattgcaaaaaatgttgcacatcttgttgtgtccattttcttagttgttgtcacatta 3440428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98654 times since January 2019
Visitors: 2275