View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-1 (Length: 199)

Name: F9134J-LTR4-TNT-insertion-1
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9134J-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (4-189)||(14518176-14518361)

Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 4 - 189
Target Start/End: Complemental strand, 14518361 - 14518176
4 aacactgatggcattcacttgcaaaatacacaggatgtagaaattcaacactctaatattggaactggtaagacattaaattaatttattttatatgact 103  Q
14518361 aacactgatggcattcacttgcaaaatacacaggatgtagaaattcaacactctaatattggaactggtaagacattaaattaatttattttatatgact 14518262  T
104 atctatctagcatcggcaattcggattaaagaagtgtcttgtatccgacactgagacgacattgacacgtgtggtttcgttcaatt 189  Q
14518261 atctatctagcatcggcaattcggattaaagaagtgtcttgtatccgacactgagacgacattgacacgtgtggtttcgttcaatt 14518176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 1059346 times since January 2019
Visitors: 949