View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-2 (Length: 56)

Name: F9134J-LTR4-TNT-insertion-2
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9134J-LTR4-TNT-insertion-2
[»] chr4 (1 HSPs)
chr4 (10-46)||(21164295-21164331)

Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.0000000000009; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 21164331 - 21164295
10 ctatattatgatgatagcaacagaaaagtttggaatt 46  Q
21164331 ctatattatgatgatagcaacagaaaagtttggaatt 21164295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 151975 times since January 2019
Visitors: 1579