View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-3 (Length: 171)

Name: F9134J-LTR4-TNT-insertion-3
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9134J-LTR4-TNT-insertion-3
F9134J-LTR4-TNT-insertion-3
[»] chr3 (1 HSPs)
chr3 (55-104)||(46893657-46893706)
[»] chr4 (1 HSPs)
chr4 (8-44)||(21164295-21164331)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 7e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 7e-20
Query Start/End: Original strand, 55 - 104
Target Start/End: Original strand, 46893657 - 46893706
Alignment:
55 gtgaatgatgtttcttagttaaagcacatgctcttcaagtgcagcaaaca 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
46893657 gtgaatgatgtttcttagttaaagcacatgctcttcaagtgcagcaaaca 46893706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 21164331 - 21164295
Alignment:
8 ctatattatgatgatagcaacagaaaagtttggaatt 44  Q
    |||||||||||||||||||||||||||||||||||||    
21164331 ctatattatgatgatagcaacagaaaagtttggaatt 21164295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 152024 times since January 2019
Visitors: 1579