View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-4 (Length: 400)

Name: F9134J-LTR4-TNT-insertion-4
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9134J-LTR4-TNT-insertion-4
[»] chr2 (8 HSPs)
chr2 (8-390)||(2662542-2662924)
chr2 (261-360)||(34328561-34328660)
chr2 (8-54)||(2707390-2707436)
chr2 (274-358)||(2712955-2713039)
chr2 (8-54)||(2717160-2717206)
chr2 (8-54)||(2723782-2723828)
chr2 (8-54)||(2745612-2745658)
chr2 (14-54)||(2712642-2712682)
[»] chr3 (7 HSPs)
chr3 (267-360)||(1107248-1107341)
chr3 (279-360)||(1077047-1077128)
chr3 (279-360)||(1090853-1090934)
chr3 (279-360)||(1299892-1299973)
chr3 (279-360)||(1050130-1050211)
chr3 (285-360)||(13854819-13854894)
chr3 (264-359)||(20342720-20342815)
[»] chr8 (4 HSPs)
chr8 (264-360)||(4131083-4131179)
chr8 (248-302)||(19186853-19186907)
chr8 (262-346)||(23341755-23341839)
chr8 (262-346)||(23385295-23385379)
[»] chr1 (1 HSPs)
chr1 (264-360)||(21936072-21936168)
[»] scaffold0090 (1 HSPs)
scaffold0090 (285-360)||(8602-8677)
[»] chr5 (2 HSPs)
chr5 (276-355)||(28419616-28419695)
chr5 (270-355)||(22689657-22689742)
[»] chr4 (2 HSPs)
chr4 (11-72)||(31697086-31697147)
chr4 (8-81)||(14519980-14520053)
[»] chr6 (1 HSPs)
chr6 (262-360)||(3979345-3979443)
[»] chr7 (1 HSPs)
chr7 (13-54)||(20284879-20284920)

Alignment Details
Target: chr2 (Bit Score: 383; Significance: 0; HSPs: 8)
Name: chr2

Target: chr2; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 8 - 390
Target Start/End: Original strand, 2662542 - 2662924
8 tttagatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaatgccgtcaataatgtctagcctcttttgccaactaa 107  Q
2662542 tttagatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaatgccgtcaataatgtctagcctcttttgccaactaa 2662641  T
108 gcgcagaacgcttggtttcatctgattcagaatattacttgagttataaagtataaaaatgatcaagtaaaatacatgtttgttccaattaacattgttt 207  Q
2662642 gcgcagaacgcttggtttcatctgattcagaatattacttgagttataaagtataaaaatgatcaagtaaaatacatgtttgttccaattaacattgttt 2662741  T
208 atgcataattagatgtgacaatgatatagttgagagaccaaccaaataataaagagtccaagcttctatttggcatatattcatagaccaacattttatc 307  Q
2662742 atgcataattagatgtgacaatgatatagttgagagaccaaccaaataataaagagtccaagcttctatttggcatatattcatagaccaacattttatc 2662841  T
308 ttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagttgtgagatgaatatgacctcattcttgaatt 390  Q
2662842 ttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagttgtgagatgaatatgacctcattcttgaatt 2662924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 261 - 360
Target Start/End: Complemental strand, 34328660 - 34328561
261 gagtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| || ||||| ||||| |||||||| |||| |||||| || ||||||| ||  ||||||||||||||||| || |||||||| ||||||||||    
34328660 gagtccaaactactattaggcatgtattcataaaccagcattttctcctctccttcaaggcaacaaccaagaagctttacaagatttcggtgttgaagtt 34328561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2707390 - 2707436
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| |||||||||||||||||||||    
2707390 tttaggtctctatgtattattcttaatcttgaatctctatgaagata 2707436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 358
Target Start/End: Original strand, 2712955 - 2713039
274 tatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaag 358  Q
    |||| ||||| |||||||||||||||||||| ||||| ||||  || |||||||| |||||  | || ||||| |||||||||||    
2712955 tattcggcatgtattcatagaccaacattttttcttccccttcgatgcaacaacctagaagtcttacaagattgcgatgttgaag 2713039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2717160 - 2717206
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| ||| |||||||||||||||||    
2717160 tttaggtctctatggattattcttaatctcgaatctctatgaagata 2717206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2723782 - 2723828
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| ||| |||||||||||||||||    
2723782 tttaggtctctatgtattattcttaatctcgaatctctatgaagata 2723828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2745612 - 2745658
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| ||| |||||||||||||||||    
2745612 tttaggtctctatgtattattcttaatctcgaatctctatgaagata 2745658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 2712642 - 2712682
14 tctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    |||||||| |||||||||| ||||||||||| |||||||||    
2712642 tctctatgtattattcttaatcttgaatctcgatgaagata 2712682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 3e-24; HSPs: 7)
Name: chr3

Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 267 - 360
Target Start/End: Complemental strand, 1107341 - 1107248
267 aagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| || ||||||||||||||||  | |||||| |||||||||||||||||||||||||||| |||||| |||||||| ||||||||||    
1107341 aagcttctgttcggcatatattcatagataagcattttctcttctccttgaatacaacaaccaagaaccttgacaagatttcggtgttgaagtt 1107248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 279 - 360
Target Start/End: Complemental strand, 1077128 - 1077047
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||||||||||||||    
1077128 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcgatgttgaagtt 1077047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 279 - 360
Target Start/End: Complemental strand, 1090934 - 1090853
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||||||||||||||    
1090934 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcgatgttgaagtt 1090853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 279 - 360
Target Start/End: Original strand, 1299892 - 1299973
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||||||||||||||    
1299892 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcgatgttgaagtt 1299973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 360
Target Start/End: Complemental strand, 1050211 - 1050130
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||| ||||||||||    
1050211 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcggtgttgaagtt 1050130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 285 - 360
Target Start/End: Complemental strand, 13854894 - 13854819
285 tattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| | ||||||||| |||||||||| |||||||||||||| || ||| || |||||||| ||||||||||    
13854894 tattcatatatcaacattttctcttctccttcaatacaacaaccaacaacctttacaagatttcggtgttgaagtt 13854819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 359
Target Start/End: Original strand, 20342720 - 20342815
264 tccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagt 359  Q
    ||||||||||| || |||||  ||||||||| |||||| || || |||  ||||||| ||||||||||||| || || ||||| || |||||||||    
20342720 tccaagcttctgttgggcatgaattcatagatcaacatcttttcatcttgttgaatagaacaaccaagaagttttacaagattacggtgttgaagt 20342815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000009; HSPs: 4)
Name: chr8

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 264 - 360
Target Start/End: Original strand, 4131083 - 4131179
264 tccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||| ||| ||||||||||  | ||||||||||||||||| ||| ||| || || |||||||||||||||  | || ||||| |||||||||||||    
4131083 tccaaacttttatttggcatgaactcatagaccaacattttctctcctctttcaacacaacaaccaagaagtcttacaagattgcgatgttgaagtt 4131179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 248 - 302
Target Start/End: Complemental strand, 19186907 - 19186853
248 accaaataataaagagtccaagcttctatttggcatatattcatagaccaacatt 302  Q
    ||||||||| ||  ||||||||||||| ||||||||||| ||||||| |||||||    
19186907 accaaataaaaagaagtccaagcttctgtttggcatatactcatagatcaacatt 19186853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 346
Target Start/End: Original strand, 23341755 - 23341839
262 agtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatt 346  Q
    |||| ||||| | ||| ||||| |||||||||| ||||| ||| || ||||  |||||||||||||| |||||||| || |||||    
23341755 agtctaagctccgattgggcatgtattcatagatcaacaatttttcctctctgtgaatacaacaaccgagaagcttcacaagatt 23341839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 346
Target Start/End: Complemental strand, 23385379 - 23385295
262 agtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatt 346  Q
    |||| ||||| | ||| ||||| |||||||||| ||||| ||| || ||||  |||||||||||||| |||||||| || |||||    
23385379 agtctaagctccgattgggcatgtattcatagatcaacaatttttcctctctgtgaatacaacaaccgagaagcttcacaagatt 23385295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 264 - 360
Target Start/End: Complemental strand, 21936168 - 21936072
264 tccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||||||||||||||| || ||||| || || ||||||| || |||| |||| |||||  | || |  ||||||||||||||||    
21936168 tccaagcttctatttggcatatattcatatactaacatcttttcatctccttcaacacaataacctagaagtctaaccaagtttcgatgttgaagtt 21936072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0090 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0090

Target: scaffold0090; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 285 - 360
Target Start/End: Original strand, 8602 - 8677
285 tattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| | ||||||||| || ||||||| |||||||||||||| || ||| || |||||||| ||||||||||    
8602 tattcataaatcaacattttctcatctccttcaatacaacaaccaacaaccttaacaagatttcggtgttgaagtt 8677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 276 - 355
Target Start/End: Complemental strand, 28419695 - 28419616
276 tttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttg 355  Q
    |||||||| ||||||||||  |||| ||| || ||||||| ||| ||||||||||||| ||| || ||||||||||||||    
28419695 tttggcatgtattcatagattaacagtttttcatctccttcaatgcaacaaccaagaaccttaacaagatttcgatgttg 28419616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 355
Target Start/End: Original strand, 22689657 - 22689742
270 cttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttg 355  Q
    |||||||| ||||| || || ||||  |||||||| || ||||||| ||| |||||||||| || ||| || ||||||||||||||    
22689657 cttctattcggcatgtactcgtagagtaacattttctcgtctccttcaatgcaacaaccaataaccttaacaagatttcgatgttg 22689742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr4

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 31697147 - 31697086
11 agatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaat 72  Q
    |||||||||||||| ||||||| ||  ||||||  ||||||||| |||||||||||||||||    
31697147 agatctctatgaataattcttaatcgagaatcttgatgaagatacacaagtcccctagcaat 31697086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 14519980 - 14520053
8 tttagatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaatgccgtcaat 81  Q
    |||||||||| |||||||||||| ||||||||||| | ||| ||||| |  ||||| || |||||||| |||||    
14519980 tttagatctcgatgaattattctgagtcttgaatcgcgatgcagataaagtagtcctcttgcaatgccttcaat 14520053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 360
Target Start/End: Original strand, 3979345 - 3979443
262 agtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||| | || ||||| |||||||||| || |||| | ||| |||||| ||| || || |||||||| ||||| ||||| || ||||||||||    
3979345 agtccaagcttttgttgggcatgtattcatagatcagcattgtttctcctccttcaatgcagcatccaagaagtttgacaagattacggtgttgaagtt 3979443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 20284920 - 20284879
13 atctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    |||||||||||| ||||||||||| |||||||| ||||||||    
20284920 atctctatgaataattcttagtctagaatctctgtgaagata 20284879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 93503 times since January 2019
Visitors: 2365