View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-4 (Length: 400)

Name: F9134J-LTR4-TNT-insertion-4
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9134J-LTR4-TNT-insertion-4
F9134J-LTR4-TNT-insertion-4
[»] chr2 (8 HSPs)
chr2 (8-390)||(2662542-2662924)
chr2 (261-360)||(34328561-34328660)
chr2 (8-54)||(2707390-2707436)
chr2 (274-358)||(2712955-2713039)
chr2 (8-54)||(2717160-2717206)
chr2 (8-54)||(2723782-2723828)
chr2 (8-54)||(2745612-2745658)
chr2 (14-54)||(2712642-2712682)
[»] chr3 (7 HSPs)
chr3 (267-360)||(1107248-1107341)
chr3 (279-360)||(1077047-1077128)
chr3 (279-360)||(1090853-1090934)
chr3 (279-360)||(1299892-1299973)
chr3 (279-360)||(1050130-1050211)
chr3 (285-360)||(13854819-13854894)
chr3 (264-359)||(20342720-20342815)
[»] chr8 (4 HSPs)
chr8 (264-360)||(4131083-4131179)
chr8 (248-302)||(19186853-19186907)
chr8 (262-346)||(23341755-23341839)
chr8 (262-346)||(23385295-23385379)
[»] chr1 (1 HSPs)
chr1 (264-360)||(21936072-21936168)
[»] scaffold0090 (1 HSPs)
scaffold0090 (285-360)||(8602-8677)
[»] chr5 (2 HSPs)
chr5 (276-355)||(28419616-28419695)
chr5 (270-355)||(22689657-22689742)
[»] chr4 (2 HSPs)
chr4 (11-72)||(31697086-31697147)
chr4 (8-81)||(14519980-14520053)
[»] chr6 (1 HSPs)
chr6 (262-360)||(3979345-3979443)
[»] chr7 (1 HSPs)
chr7 (13-54)||(20284879-20284920)


Alignment Details
Target: chr2 (Bit Score: 383; Significance: 0; HSPs: 8)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 383; E-Value: 0
Query Start/End: Original strand, 8 - 390
Target Start/End: Original strand, 2662542 - 2662924
Alignment:
8 tttagatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaatgccgtcaataatgtctagcctcttttgccaactaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2662542 tttagatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaatgccgtcaataatgtctagcctcttttgccaactaa 2662641  T
108 gcgcagaacgcttggtttcatctgattcagaatattacttgagttataaagtataaaaatgatcaagtaaaatacatgtttgttccaattaacattgttt 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2662642 gcgcagaacgcttggtttcatctgattcagaatattacttgagttataaagtataaaaatgatcaagtaaaatacatgtttgttccaattaacattgttt 2662741  T
208 atgcataattagatgtgacaatgatatagttgagagaccaaccaaataataaagagtccaagcttctatttggcatatattcatagaccaacattttatc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2662742 atgcataattagatgtgacaatgatatagttgagagaccaaccaaataataaagagtccaagcttctatttggcatatattcatagaccaacattttatc 2662841  T
308 ttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagttgtgagatgaatatgacctcattcttgaatt 390  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2662842 ttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagttgtgagatgaatatgacctcattcttgaatt 2662924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 261 - 360
Target Start/End: Complemental strand, 34328660 - 34328561
Alignment:
261 gagtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| || ||||| ||||| |||||||| |||| |||||| || ||||||| ||  ||||||||||||||||| || |||||||| ||||||||||    
34328660 gagtccaaactactattaggcatgtattcataaaccagcattttctcctctccttcaaggcaacaaccaagaagctttacaagatttcggtgttgaagtt 34328561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2707390 - 2707436
Alignment:
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| |||||||||||||||||||||    
2707390 tttaggtctctatgtattattcttaatcttgaatctctatgaagata 2707436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 274 - 358
Target Start/End: Original strand, 2712955 - 2713039
Alignment:
274 tatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaag 358  Q
    |||| ||||| |||||||||||||||||||| ||||| ||||  || |||||||| |||||  | || ||||| |||||||||||    
2712955 tattcggcatgtattcatagaccaacattttttcttccccttcgatgcaacaacctagaagtcttacaagattgcgatgttgaag 2713039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2717160 - 2717206
Alignment:
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| ||| |||||||||||||||||    
2717160 tttaggtctctatggattattcttaatctcgaatctctatgaagata 2717206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2723782 - 2723828
Alignment:
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| ||| |||||||||||||||||    
2723782 tttaggtctctatgtattattcttaatctcgaatctctatgaagata 2723828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 8 - 54
Target Start/End: Original strand, 2745612 - 2745658
Alignment:
8 tttagatctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    ||||| |||||||| |||||||||| ||| |||||||||||||||||    
2745612 tttaggtctctatgtattattcttaatctcgaatctctatgaagata 2745658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 14 - 54
Target Start/End: Original strand, 2712642 - 2712682
Alignment:
14 tctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    |||||||| |||||||||| ||||||||||| |||||||||    
2712642 tctctatgtattattcttaatcttgaatctcgatgaagata 2712682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 3e-24; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 267 - 360
Target Start/End: Complemental strand, 1107341 - 1107248
Alignment:
267 aagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| || ||||||||||||||||  | |||||| |||||||||||||||||||||||||||| |||||| |||||||| ||||||||||    
1107341 aagcttctgttcggcatatattcatagataagcattttctcttctccttgaatacaacaaccaagaaccttgacaagatttcggtgttgaagtt 1107248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 279 - 360
Target Start/End: Complemental strand, 1077128 - 1077047
Alignment:
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||||||||||||||    
1077128 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcgatgttgaagtt 1077047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 279 - 360
Target Start/End: Complemental strand, 1090934 - 1090853
Alignment:
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||||||||||||||    
1090934 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcgatgttgaagtt 1090853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 279 - 360
Target Start/End: Original strand, 1299892 - 1299973
Alignment:
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||||||||||||||    
1299892 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcgatgttgaagtt 1299973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 279 - 360
Target Start/End: Complemental strand, 1050211 - 1050130
Alignment:
279 ggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||  | |||| | |||||||||||||| ||||||||||||| ||| || |||||||| ||||||||||    
1050211 ggcatatattcatagataagcattctctcttctccttgaatgcaacaaccaagaaccttaacaagatttcggtgttgaagtt 1050130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 285 - 360
Target Start/End: Complemental strand, 13854894 - 13854819
Alignment:
285 tattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| | ||||||||| |||||||||| |||||||||||||| || ||| || |||||||| ||||||||||    
13854894 tattcatatatcaacattttctcttctccttcaatacaacaaccaacaacctttacaagatttcggtgttgaagtt 13854819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 264 - 359
Target Start/End: Original strand, 20342720 - 20342815
Alignment:
264 tccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagt 359  Q
    ||||||||||| || |||||  ||||||||| |||||| || || |||  ||||||| ||||||||||||| || || ||||| || |||||||||    
20342720 tccaagcttctgttgggcatgaattcatagatcaacatcttttcatcttgttgaatagaacaaccaagaagttttacaagattacggtgttgaagt 20342815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000009; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 264 - 360
Target Start/End: Original strand, 4131083 - 4131179
Alignment:
264 tccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||| ||| ||||||||||  | ||||||||||||||||| ||| ||| || || |||||||||||||||  | || ||||| |||||||||||||    
4131083 tccaaacttttatttggcatgaactcatagaccaacattttctctcctctttcaacacaacaaccaagaagtcttacaagattgcgatgttgaagtt 4131179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 248 - 302
Target Start/End: Complemental strand, 19186907 - 19186853
Alignment:
248 accaaataataaagagtccaagcttctatttggcatatattcatagaccaacatt 302  Q
    ||||||||| ||  ||||||||||||| ||||||||||| ||||||| |||||||    
19186907 accaaataaaaagaagtccaagcttctgtttggcatatactcatagatcaacatt 19186853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 346
Target Start/End: Original strand, 23341755 - 23341839
Alignment:
262 agtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatt 346  Q
    |||| ||||| | ||| ||||| |||||||||| ||||| ||| || ||||  |||||||||||||| |||||||| || |||||    
23341755 agtctaagctccgattgggcatgtattcatagatcaacaatttttcctctctgtgaatacaacaaccgagaagcttcacaagatt 23341839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 262 - 346
Target Start/End: Complemental strand, 23385379 - 23385295
Alignment:
262 agtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatt 346  Q
    |||| ||||| | ||| ||||| |||||||||| ||||| ||| || ||||  |||||||||||||| |||||||| || |||||    
23385379 agtctaagctccgattgggcatgtattcatagatcaacaatttttcctctctgtgaatacaacaaccgagaagcttcacaagatt 23385295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 264 - 360
Target Start/End: Complemental strand, 21936168 - 21936072
Alignment:
264 tccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||||||||||||||||||||| || ||||| || || ||||||| || |||| |||| |||||  | || |  ||||||||||||||||    
21936168 tccaagcttctatttggcatatattcatatactaacatcttttcatctccttcaacacaataacctagaagtctaaccaagtttcgatgttgaagtt 21936072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0090 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0090
Description:

Target: scaffold0090; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 285 - 360
Target Start/End: Original strand, 8602 - 8677
Alignment:
285 tattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    |||||||| | ||||||||| || ||||||| |||||||||||||| || ||| || |||||||| ||||||||||    
8602 tattcataaatcaacattttctcatctccttcaatacaacaaccaacaaccttaacaagatttcggtgttgaagtt 8677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 276 - 355
Target Start/End: Complemental strand, 28419695 - 28419616
Alignment:
276 tttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttg 355  Q
    |||||||| ||||||||||  |||| ||| || ||||||| ||| ||||||||||||| ||| || ||||||||||||||    
28419695 tttggcatgtattcatagattaacagtttttcatctccttcaatgcaacaaccaagaaccttaacaagatttcgatgttg 28419616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 270 - 355
Target Start/End: Original strand, 22689657 - 22689742
Alignment:
270 cttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttg 355  Q
    |||||||| ||||| || || ||||  |||||||| || ||||||| ||| |||||||||| || ||| || ||||||||||||||    
22689657 cttctattcggcatgtactcgtagagtaacattttctcgtctccttcaatgcaacaaccaataaccttaacaagatttcgatgttg 22689742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 11 - 72
Target Start/End: Complemental strand, 31697147 - 31697086
Alignment:
11 agatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaat 72  Q
    |||||||||||||| ||||||| ||  ||||||  ||||||||| |||||||||||||||||    
31697147 agatctctatgaataattcttaatcgagaatcttgatgaagatacacaagtcccctagcaat 31697086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 14519980 - 14520053
Alignment:
8 tttagatctctatgaattattcttagtcttgaatctctatgaagatagacaagtcccctagcaatgccgtcaat 81  Q
    |||||||||| |||||||||||| ||||||||||| | ||| ||||| |  ||||| || |||||||| |||||    
14519980 tttagatctcgatgaattattctgagtcttgaatcgcgatgcagataaagtagtcctcttgcaatgccttcaat 14520053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 262 - 360
Target Start/End: Original strand, 3979345 - 3979443
Alignment:
262 agtccaagcttctatttggcatatattcatagaccaacattttatcttctccttgaatacaacaaccaagaagcttgacgagatttcgatgttgaagtt 360  Q
    ||||||||||| | || ||||| |||||||||| || |||| | ||| |||||| ||| || || |||||||| ||||| ||||| || ||||||||||    
3979345 agtccaagcttttgttgggcatgtattcatagatcagcattgtttctcctccttcaatgcagcatccaagaagtttgacaagattacggtgttgaagtt 3979443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 20284920 - 20284879
Alignment:
13 atctctatgaattattcttagtcttgaatctctatgaagata 54  Q
    |||||||||||| ||||||||||| |||||||| ||||||||    
20284920 atctctatgaataattcttagtctagaatctctgtgaagata 20284879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC