View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-5 (Length: 302)

Name: F9134J-LTR4-TNT-insertion-5
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9134J-LTR4-TNT-insertion-5
F9134J-LTR4-TNT-insertion-5
[»] chr5 (1 HSPs)
chr5 (11-292)||(737966-738247)


Alignment Details
Target: chr5 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 11 - 292
Target Start/End: Original strand, 737966 - 738247
Alignment:
11 agtcccacattcgctagacaagatcattcgagtaccttaagctctcattcgactacaagatctatagaacattaaggcaaatctcaagcatatgtatgat 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
737966 agtcccacattcgctagacaagatcattcgagtaccttaagctctcattcgactacaagatctatagaacattaaggcaaatctcaagcatatgtatgat 738065  T
111 ggaccatcctaaagcaaacatatgatttttacctatttttaatcagggattaagatctgattgcttaagggcnnnnnnnngagatttttatattgttaaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||    
738066 ggaccatcctaaagcaaacatatgatttttacctatttttaatcagggattaagatctgattgcttaagggcaaaaaaaagagatttttatattgttaaa 738165  T
211 gtcattacttacagagagatgttatgtaaagtaaaaaataattgtgtttatttactaccataaaatgtacttaaatttatta 292  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
738166 gtcattacttacagagagatgttatgtaaagtaaaaaataattgtgtttatttactaccataaaatgtacttaaatttatta 738247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC