View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-6 (Length: 317)

Name: F9134J-LTR4-TNT-insertion-6
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9134J-LTR4-TNT-insertion-6
[»] chr5 (3 HSPs)
chr5 (8-307)||(15423046-15423345)
chr5 (196-250)||(15081535-15081589)
chr5 (238-282)||(15431536-15431580)

Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr5

Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 8 - 307
Target Start/End: Original strand, 15423046 - 15423345
8 gagaatcacatgggtgagaggttcagcgagaggaaattgtggaagaaaggtgagtgttaataatttactgtaaaaacagggttannnnnnncttgttagg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||    
15423046 gagaatcacatgggtgagaggttcagcgagaggaaattgtggaagaaaggtgagtgttaataatttactgtaaaaacagggttatttttttcttgttagg 15423145  T
108 gtgtaatcagttttttaggatgtaactaggtttattaagtgcttgttgttttgtatttttctcattcattactcaaagcattatttggtttaaaaattcg 207  Q
15423146 gtgtaatcagttttttaggatgtaactaggtttattaagtgcttgttgttttgtatttttctcattcattactcaaagcattatttggtttaaaaattcg 15423245  T
208 gtagtttaaattcttcggctgaatactaccaacaatttggggcatttgctcggatacaaacctagttttcttcaatcgaataattgggcccaagttatta 307  Q
15423246 gtagtttaaattcttcggctgaatactaccaacaatttggggcatttgctcggatacaaacctagttttcttcaatcgaataattgggcccaagttatta 15423345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 196 - 250
Target Start/End: Complemental strand, 15081589 - 15081535
196 tttaaaaattcggtagtttaaattcttcggctgaatactaccaacaatttggggc 250  Q
    ||||||||||||||| ||||||||| ||||||||||||||| || || |||||||    
15081589 tttaaaaattcggtattttaaattcatcggctgaatactacaaaaaaattggggc 15081535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 282
Target Start/End: Original strand, 15431536 - 15431580
238 aacaatttggggcatttgctcggatacaaacctagttttcttcaa 282  Q
    ||||| ||||||| |||| | ||||||||||||||||||||||||    
15431536 aacaaattggggcttttggttggatacaaacctagttttcttcaa 15431580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 1059702 times since January 2019
Visitors: 982