View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-6 (Length: 317)

Name: F9134J-LTR4-TNT-insertion-6
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9134J-LTR4-TNT-insertion-6
F9134J-LTR4-TNT-insertion-6
[»] chr5 (3 HSPs)
chr5 (8-307)||(15423046-15423345)
chr5 (196-250)||(15081535-15081589)
chr5 (238-282)||(15431536-15431580)


Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 8 - 307
Target Start/End: Original strand, 15423046 - 15423345
Alignment:
8 gagaatcacatgggtgagaggttcagcgagaggaaattgtggaagaaaggtgagtgttaataatttactgtaaaaacagggttannnnnnncttgttagg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||    
15423046 gagaatcacatgggtgagaggttcagcgagaggaaattgtggaagaaaggtgagtgttaataatttactgtaaaaacagggttatttttttcttgttagg 15423145  T
108 gtgtaatcagttttttaggatgtaactaggtttattaagtgcttgttgttttgtatttttctcattcattactcaaagcattatttggtttaaaaattcg 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15423146 gtgtaatcagttttttaggatgtaactaggtttattaagtgcttgttgttttgtatttttctcattcattactcaaagcattatttggtttaaaaattcg 15423245  T
208 gtagtttaaattcttcggctgaatactaccaacaatttggggcatttgctcggatacaaacctagttttcttcaatcgaataattgggcccaagttatta 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15423246 gtagtttaaattcttcggctgaatactaccaacaatttggggcatttgctcggatacaaacctagttttcttcaatcgaataattgggcccaagttatta 15423345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 196 - 250
Target Start/End: Complemental strand, 15081589 - 15081535
Alignment:
196 tttaaaaattcggtagtttaaattcttcggctgaatactaccaacaatttggggc 250  Q
    ||||||||||||||| ||||||||| ||||||||||||||| || || |||||||    
15081589 tttaaaaattcggtattttaaattcatcggctgaatactacaaaaaaattggggc 15081535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 282
Target Start/End: Original strand, 15431536 - 15431580
Alignment:
238 aacaatttggggcatttgctcggatacaaacctagttttcttcaa 282  Q
    ||||| ||||||| |||| | ||||||||||||||||||||||||    
15431536 aacaaattggggcttttggttggatacaaacctagttttcttcaa 15431580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC