View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-7 (Length: 273)

Name: F9134J-LTR4-TNT-insertion-7
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9134J-LTR4-TNT-insertion-7
F9134J-LTR4-TNT-insertion-7
[»] chr2 (39 HSPs)
chr2 (7-224)||(14432096-14432313)
chr2 (7-178)||(11090521-11090692)
chr2 (7-175)||(40027143-40027311)
chr2 (10-178)||(40815722-40815890)
chr2 (13-175)||(22374323-22374485)
chr2 (7-175)||(239356-239523)
chr2 (7-175)||(18451205-18451373)
chr2 (9-175)||(1978111-1978277)
chr2 (7-175)||(28616616-28616785)
chr2 (7-175)||(43058336-43058504)
chr2 (7-178)||(3025466-3025636)
chr2 (9-176)||(8425736-8425903)
chr2 (13-175)||(26538100-26538262)
chr2 (9-175)||(26538454-26538621)
chr2 (18-175)||(40815348-40815506)
chr2 (22-175)||(7446345-7446497)
chr2 (18-175)||(18450833-18450991)
chr2 (37-175)||(20444752-20444890)
chr2 (18-175)||(22374709-22374867)
chr2 (18-175)||(7446730-7446888)
chr2 (18-178)||(40027524-40027685)
chr2 (37-175)||(35781067-35781205)
chr2 (18-175)||(11090904-11091062)
chr2 (37-175)||(35779711-35779849)
chr2 (18-171)||(239736-239890)
chr2 (37-175)||(20440436-20440573)
chr2 (18-175)||(28616998-28617156)
chr2 (18-175)||(43058717-43058874)
chr2 (52-175)||(1978528-1978651)
chr2 (19-176)||(8425357-8425514)
chr2 (18-175)||(14432525-14432683)
chr2 (61-175)||(28847123-28847237)
chr2 (36-175)||(15551502-15551641)
chr2 (37-175)||(8972240-8972378)
chr2 (19-175)||(3025848-3026003)
chr2 (38-175)||(15552459-15552595)
chr2 (7-175)||(28143405-28143572)
chr2 (38-178)||(3824114-3824254)
chr2 (20-175)||(31797166-31797320)
[»] chr7 (32 HSPs)
chr7 (7-178)||(19830420-19830591)
chr7 (7-175)||(37786770-37786938)
chr7 (7-175)||(19590528-19590696)
chr7 (7-188)||(2659214-2659395)
chr7 (7-175)||(32004988-32005156)
chr7 (10-175)||(38858646-38858811)
chr7 (7-178)||(29100225-29100396)
chr7 (7-178)||(4641440-4641611)
chr7 (7-175)||(35289275-35289443)
chr7 (11-175)||(34534169-34534333)
chr7 (9-172)||(23953105-23953268)
chr7 (9-178)||(4478076-4478245)
chr7 (18-175)||(19590909-19591067)
chr7 (18-175)||(2658842-2659000)
chr7 (18-175)||(38859025-38859183)
chr7 (40-175)||(28583442-28583577)
chr7 (18-175)||(19830804-19830961)
chr7 (19-175)||(32004617-32004774)
chr7 (20-175)||(37787153-37787309)
chr7 (18-175)||(34533794-34533952)
chr7 (19-175)||(35288906-35289063)
chr7 (18-165)||(29099863-29100011)
chr7 (36-175)||(38160954-38161093)
chr7 (18-175)||(4641828-4641983)
chr7 (18-175)||(23952733-23952892)
chr7 (37-175)||(28584326-28584464)
chr7 (9-44)||(32427397-32427432)
chr7 (7-93)||(35579261-35579347)
chr7 (18-175)||(34595158-34595315)
chr7 (7-93)||(35578983-35579069)
chr7 (19-175)||(9393739-9393894)
chr7 (103-175)||(49064037-49064109)
[»] scaffold0295 (2 HSPs)
scaffold0295 (7-175)||(4796-4964)
scaffold0295 (18-175)||(5179-5333)
[»] chr6 (37 HSPs)
chr6 (7-175)||(10900304-10900472)
chr6 (7-175)||(20741103-20741271)
chr6 (7-175)||(1149805-1149974)
chr6 (7-175)||(15828015-15828183)
chr6 (10-175)||(18257140-18257305)
chr6 (7-175)||(11276956-11277124)
chr6 (9-175)||(31470692-31470858)
chr6 (18-175)||(2319675-2319832)
chr6 (7-175)||(12935531-12935699)
chr6 (7-175)||(11444990-11445158)
chr6 (7-175)||(28472640-28472807)
chr6 (7-175)||(29859829-29859996)
chr6 (7-177)||(2322593-2322762)
chr6 (9-176)||(10899941-10900109)
chr6 (19-175)||(18505305-18505461)
chr6 (18-175)||(12935160-12935318)
chr6 (11-175)||(23074002-23074155)
chr6 (18-175)||(23075512-23075670)
chr6 (15-175)||(4811375-4811535)
chr6 (18-189)||(11445371-11445543)
chr6 (18-175)||(22219737-22219895)
chr6 (18-177)||(18504920-18505080)
chr6 (9-175)||(11276593-11276760)
chr6 (25-175)||(15827641-15827794)
chr6 (18-175)||(31470318-31470476)
chr6 (18-175)||(20741485-20741646)
chr6 (61-175)||(18257565-18257679)
chr6 (36-175)||(29033437-29033577)
chr6 (70-175)||(4811693-4811798)
chr6 (42-178)||(3835135-3835271)
chr6 (36-175)||(29035040-29035179)
chr6 (37-175)||(18296148-18296285)
chr6 (92-175)||(1149468-1149551)
chr6 (7-85)||(35163561-35163639)
chr6 (36-194)||(835378-835535)
chr6 (122-175)||(22534214-22534267)
chr6 (36-100)||(33096011-33096075)
[»] chr5 (48 HSPs)
chr5 (7-175)||(19359139-19359307)
chr5 (7-175)||(2865129-2865297)
chr5 (7-175)||(18183343-18183511)
chr5 (10-175)||(8647441-8647606)
chr5 (7-175)||(5819303-5819471)
chr5 (7-175)||(24362210-24362378)
chr5 (11-178)||(15372251-15372418)
chr5 (7-175)||(15708974-15709141)
chr5 (7-175)||(8460933-8461101)
chr5 (7-175)||(14215617-14215785)
chr5 (11-175)||(29455120-29455284)
chr5 (7-175)||(164565-164733)
chr5 (13-175)||(14463901-14464062)
chr5 (18-191)||(18182957-18183131)
chr5 (18-178)||(5818929-5819090)
chr5 (18-175)||(2864757-2864915)
chr5 (18-172)||(24361843-24361997)
chr5 (18-175)||(8647822-8647980)
chr5 (18-175)||(19359520-19359678)
chr5 (18-172)||(24325218-24325372)
chr5 (7-175)||(16018592-16018758)
chr5 (18-175)||(8461315-8461473)
chr5 (18-175)||(14215244-14215402)
chr5 (11-156)||(25000112-25000257)
chr5 (7-175)||(24331934-24332106)
chr5 (16-178)||(16018969-16019132)
chr5 (19-175)||(164194-164350)
chr5 (16-175)||(25000471-25000631)
chr5 (18-175)||(29454743-29454901)
chr5 (18-175)||(24331562-24331722)
chr5 (36-175)||(7349420-7349559)
chr5 (18-175)||(15709353-15709510)
chr5 (58-175)||(4222147-4222264)
chr5 (19-175)||(15371874-15372030)
chr5 (52-175)||(7348562-7348685)
chr5 (40-177)||(6019177-6019314)
chr5 (38-175)||(4623151-4623286)
chr5 (39-165)||(4624631-4624757)
chr5 (40-184)||(4219657-4219800)
chr5 (39-175)||(6018317-6018452)
chr5 (36-96)||(13814131-13814190)
chr5 (16-175)||(41834443-41834602)
chr5 (18-175)||(10721789-10721945)
chr5 (52-191)||(20266335-20266474)
chr5 (7-61)||(24325585-24325639)
chr5 (7-48)||(16752711-16752752)
chr5 (52-96)||(14462686-14462730)
chr5 (11-79)||(28495220-28495288)
[»] chr1 (42 HSPs)
chr1 (7-175)||(50970652-50970820)
chr1 (7-178)||(5962952-5963123)
chr1 (7-178)||(15173096-15173267)
chr1 (7-175)||(29869623-29869791)
chr1 (9-175)||(5540194-5540360)
chr1 (9-175)||(29306956-29307122)
chr1 (10-175)||(33144296-33144461)
chr1 (7-175)||(18984122-18984290)
chr1 (7-175)||(21856417-21856585)
chr1 (9-175)||(15646571-15646737)
chr1 (7-175)||(17433219-17433387)
chr1 (7-175)||(9018976-9019144)
chr1 (7-175)||(8678916-8679083)
chr1 (15-175)||(39154022-39154182)
chr1 (9-175)||(29307317-29307484)
chr1 (11-175)||(26859438-26859601)
chr1 (16-175)||(17433597-17433757)
chr1 (18-175)||(29870003-29870161)
chr1 (18-175)||(8678544-8678702)
chr1 (18-175)||(39154404-39154562)
chr1 (20-175)||(50970281-50970437)
chr1 (18-175)||(5539819-5539977)
chr1 (18-175)||(21856045-21856203)
chr1 (19-175)||(4636356-4636513)
chr1 (18-170)||(33143925-33144078)
chr1 (18-175)||(15173478-15173635)
chr1 (18-175)||(15646195-15646353)
chr1 (18-175)||(18984503-18984661)
chr1 (9-175)||(9019338-9019505)
chr1 (7-105)||(4636045-4636143)
chr1 (61-175)||(26859062-26859176)
chr1 (38-175)||(52268293-52268430)
chr1 (18-175)||(5962581-5962739)
chr1 (18-175)||(17112285-17112442)
chr1 (103-175)||(47826967-47827039)
chr1 (62-175)||(52269177-52269290)
chr1 (92-175)||(2733416-2733499)
chr1 (78-170)||(47827033-47827125)
chr1 (8-175)||(17088516-17088682)
chr1 (51-136)||(39843195-39843280)
chr1 (38-175)||(52235074-52235211)
chr1 (67-175)||(50419695-50419803)
[»] chr3 (59 HSPs)
chr3 (7-178)||(5136980-5137151)
chr3 (7-178)||(41046700-41046871)
chr3 (7-175)||(20840563-20840731)
chr3 (7-175)||(39555951-39556119)
chr3 (7-175)||(24300930-24301098)
chr3 (7-175)||(31779026-31779194)
chr3 (7-175)||(37726932-37727100)
chr3 (7-175)||(17464865-17465034)
chr3 (7-175)||(23644465-23644633)
chr3 (7-175)||(25853601-25853769)
chr3 (7-175)||(26837730-26837897)
chr3 (9-175)||(43973444-43973610)
chr3 (23-172)||(48452995-48453144)
chr3 (7-175)||(32535333-32535505)
chr3 (7-175)||(30104485-30104652)
chr3 (7-174)||(22425187-22425354)
chr3 (9-175)||(27393953-27394119)
chr3 (7-178)||(26274941-26275111)
chr3 (18-175)||(5137365-5137523)
chr3 (37-181)||(25612381-25612525)
chr3 (18-175)||(25853237-25853395)
chr3 (18-175)||(31778656-31778814)
chr3 (18-175)||(37727314-37727472)
chr3 (18-175)||(43973824-43973982)
chr3 (18-175)||(4275748-4275906)
chr3 (18-175)||(20840945-20841103)
chr3 (18-175)||(27393664-27393822)
chr3 (18-175)||(39555581-39555739)
chr3 (18-175)||(17464494-17464652)
chr3 (18-175)||(30098147-30098305)
chr3 (18-178)||(26837360-26837521)
chr3 (16-175)||(29801798-29801958)
chr3 (18-178)||(32534959-32535120)
chr3 (18-175)||(22424817-22424975)
chr3 (18-175)||(23644849-23645007)
chr3 (57-175)||(29801359-29801477)
chr3 (18-178)||(26274567-26274728)
chr3 (36-175)||(50116812-50116951)
chr3 (39-175)||(23228414-23228549)
chr3 (37-175)||(51474737-51474876)
chr3 (18-178)||(24300557-24300717)
chr3 (38-175)||(32697106-32697242)
chr3 (18-178)||(41047083-41047242)
chr3 (34-175)||(25420542-25420683)
chr3 (40-175)||(45965941-45966076)
chr3 (64-175)||(51473431-51473542)
chr3 (37-175)||(37220560-37220698)
chr3 (7-175)||(49407799-49407966)
chr3 (7-175)||(55192121-55192288)
chr3 (92-175)||(37222030-37222113)
chr3 (11-62)||(29801532-29801583)
chr3 (37-172)||(25419150-25419285)
chr3 (9-175)||(27200069-27200234)
chr3 (50-159)||(18010162-18010271)
chr3 (36-88)||(23227346-23227398)
chr3 (7-175)||(37075689-37075859)
chr3 (9-175)||(36701473-36701639)
chr3 (51-177)||(32695704-32695830)
chr3 (8-42)||(33412383-33412417)
[»] chr8 (32 HSPs)
chr8 (7-175)||(9930031-9930199)
chr8 (11-175)||(19176668-19176832)
chr8 (7-178)||(33328158-33328329)
chr8 (7-175)||(41681137-41681304)
chr8 (7-175)||(12571866-12572035)
chr8 (11-175)||(31133223-31133387)
chr8 (7-175)||(44831619-44831787)
chr8 (9-175)||(11656458-11656625)
chr8 (7-174)||(13224645-13224811)
chr8 (11-175)||(9178014-9178177)
chr8 (18-175)||(13225023-13225181)
chr8 (18-175)||(19176293-19176451)
chr8 (18-175)||(9928912-9929070)
chr8 (18-175)||(33328524-33328682)
chr8 (18-175)||(33742925-33743082)
chr8 (18-175)||(44831250-44831408)
chr8 (18-178)||(12572235-12572396)
chr8 (20-175)||(34540934-34541090)
chr8 (18-175)||(11656841-11656999)
chr8 (18-175)||(41681518-41681676)
chr8 (19-175)||(31133605-31133762)
chr8 (7-177)||(4630166-4630330)
chr8 (7-125)||(33743293-33743411)
chr8 (24-175)||(4629800-4629952)
chr8 (40-178)||(10918126-10918264)
chr8 (70-175)||(11336959-11337064)
chr8 (37-167)||(8073956-8074085)
chr8 (37-99)||(43958264-43958326)
chr8 (145-175)||(9177670-9177700)
chr8 (137-175)||(10919690-10919728)
chr8 (18-86)||(9177724-9177793)
chr8 (7-48)||(18805292-18805333)
[»] scaffold0951 (2 HSPs)
scaffold0951 (7-175)||(1670-1838)
scaffold0951 (18-175)||(2051-2209)
[»] chr4 (63 HSPs)
chr4 (10-175)||(33109687-33109852)
chr4 (7-175)||(4219560-4219728)
chr4 (7-175)||(15523608-15523776)
chr4 (7-175)||(46193779-46193947)
chr4 (8-175)||(25447611-25447778)
chr4 (9-175)||(25937673-25937839)
chr4 (7-175)||(11153521-11153689)
chr4 (9-175)||(38962195-38962361)
chr4 (7-175)||(12234332-12234500)
chr4 (11-175)||(23494446-23494610)
chr4 (7-178)||(2118670-2118840)
chr4 (7-178)||(22434552-22434721)
chr4 (11-178)||(54995446-54995612)
chr4 (7-175)||(48526199-48526366)
chr4 (7-178)||(45082432-45082601)
chr4 (7-175)||(22170311-22170478)
chr4 (7-175)||(51020800-51020968)
chr4 (18-175)||(25447250-25447408)
chr4 (16-175)||(46193408-46193568)
chr4 (18-175)||(22434182-22434340)
chr4 (18-175)||(45082808-45082966)
chr4 (18-178)||(18751599-18751760)
chr4 (18-178)||(48526565-48526726)
chr4 (19-175)||(15523238-15523395)
chr4 (18-175)||(11153149-11153307)
chr4 (18-175)||(12234713-12234871)
chr4 (7-109)||(12503810-12503912)
chr4 (18-175)||(20470895-20471053)
chr4 (18-178)||(4219943-4220104)
chr4 (62-175)||(23494872-23494985)
chr4 (18-178)||(54995069-54995230)
chr4 (52-175)||(33109883-33110006)
chr4 (18-175)||(2118296-2118454)
chr4 (19-175)||(25938056-25938213)
chr4 (36-178)||(48713749-48713891)
chr4 (18-175)||(51021180-51021337)
chr4 (64-175)||(18763951-18764062)
chr4 (36-175)||(20958264-20958401)
chr4 (37-160)||(43243685-43243807)
chr4 (37-175)||(44892552-44892690)
chr4 (37-175)||(48293597-48293735)
chr4 (42-178)||(16690936-16691072)
chr4 (61-175)||(35363028-35363143)
chr4 (37-175)||(48294946-48295085)
chr4 (42-175)||(48708298-48708431)
chr4 (18-161)||(12503453-12503597)
chr4 (40-160)||(43281198-43281317)
chr4 (40-171)||(20957196-20957327)
chr4 (52-175)||(10258306-10258429)
chr4 (37-175)||(44890520-44890658)
chr4 (42-175)||(16691481-16691613)
chr4 (7-68)||(18751976-18752037)
chr4 (113-175)||(16318256-16318318)
chr4 (7-175)||(17503977-17504144)
chr4 (37-120)||(43242328-43242411)
chr4 (70-175)||(55189531-55189636)
chr4 (7-42)||(17504334-17504369)
chr4 (7-42)||(35193443-35193478)
chr4 (85-178)||(229161-229254)
chr4 (37-109)||(44220781-44220853)
chr4 (40-86)||(30596342-30596388)
chr4 (85-178)||(229612-229705)
chr4 (7-35)||(40160236-40160264)
[»] scaffold0273 (2 HSPs)
scaffold0273 (7-175)||(4581-4749)
scaffold0273 (18-136)||(4245-4364)
[»] scaffold0019 (1 HSPs)
scaffold0019 (7-175)||(134047-134215)
[»] scaffold0007 (4 HSPs)
scaffold0007 (7-175)||(64305-64473)
scaffold0007 (63-178)||(64735-64850)
scaffold0007 (7-175)||(205743-205910)
scaffold0007 (81-175)||(210786-210880)
[»] scaffold1223 (2 HSPs)
scaffold1223 (9-175)||(756-921)
scaffold1223 (9-175)||(1116-1283)
[»] scaffold0432 (2 HSPs)
scaffold0432 (7-175)||(10247-10414)
scaffold0432 (71-176)||(9934-10039)
[»] scaffold0417 (2 HSPs)
scaffold0417 (7-159)||(10640-10792)
scaffold0417 (18-175)||(11007-11165)
[»] scaffold0176 (2 HSPs)
scaffold0176 (11-172)||(18841-19001)
scaffold0176 (81-175)||(19069-19163)
[»] scaffold0027 (2 HSPs)
scaffold0027 (7-175)||(42533-42700)
scaffold0027 (9-178)||(42169-42339)
[»] scaffold0157 (2 HSPs)
scaffold0157 (7-109)||(16565-16667)
scaffold0157 (18-161)||(16880-17024)
[»] scaffold0113 (1 HSPs)
scaffold0113 (52-174)||(28662-28784)
[»] scaffold1585 (1 HSPs)
scaffold1585 (36-175)||(570-709)
[»] scaffold0057 (2 HSPs)
scaffold0057 (37-177)||(61862-62002)
scaffold0057 (40-175)||(61031-61166)
[»] scaffold0076 (1 HSPs)
scaffold0076 (75-178)||(8451-8554)
[»] scaffold1696 (1 HSPs)
scaffold1696 (37-174)||(454-589)
[»] scaffold0168 (1 HSPs)
scaffold0168 (36-123)||(7691-7778)


Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 39)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 224
Target Start/End: Complemental strand, 14432313 - 14432096
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14432313 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 14432214  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacccaacttttattatgatgtattgtgcaaa 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14432213 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacccaacttttattatgatgtattgtgcaaa 14432114  T
207 aacttctaaaagtatttg 224  Q
    ||||||||||||||||||    
14432113 aacttctaaaagtatttg 14432096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 11090692 - 11090521
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
11090692 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 11090593  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||| | ||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||    
11090592 gttctgttttaaaagggcaggacaagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 11090521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 40027311 - 40027143
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||    
40027311 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggagggtaggacaaaaaatgcaacaaaaatgataattgaaggaccgtttt 40027212  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||    
40027211 gttctgttttaaaagggcatgaccagtttcgtgagtaggccaaaacacgatgaccaaaagtgtaattaa 40027143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 10 - 178
Target Start/End: Original strand, 40815722 - 40815890
Alignment:
10 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| ||||||||||    
40815722 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaagggccgttttgtt 40815821  T
110 atattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
     | |||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||    
40815822 ctgttttaaaagggcattaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 40815890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 13 - 175
Target Start/End: Complemental strand, 22374485 - 22374323
Alignment:
13 taggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttata 112  Q
    ||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| |     
22374485 taggtctaaaactatcatttctttgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctg 22374386  T
113 ttttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
22374385 ttttaaaagggcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 22374323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 239523 - 239356
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
239523 aggggataggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 239424  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| |||| |||||||||| ||||||||||||||||||| ||||||||||||||||||    
239423 gttctgttttaaaa-ggcaggaccagtttcgtgagtaggccaaaacacgatgaccaaaagtgtaattaa 239356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 18451205 - 18451373
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||| |||||||||  ||||    
18451205 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaagaaaaatgcaacaaaaatgatatttgaaggactatttt 18451304  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||    
18451305 gttctgttttaaaagggcaggaccagtttcgtaagtaggccaaaacacgaggaccaaaagtgtaattaa 18451373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 9 - 175
Target Start/End: Complemental strand, 1978277 - 1978111
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||| ||||||||||||||||||||| |||||||||||||||||    
1978277 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatgggggacaggacaaaaaatgcaacaaaaatgataattgaaggaccgttttgt 1978178  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | | ||||||||||||| |||||||||| ||||||||||||||||| |||||||||| |||||||||    
1978177 tctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacaaggaccaaaaatgtaattaa 1978111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 28616785 - 28616616
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgttttt-ggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttt 105  Q
    ||||||||||||||||||||  |||||||||||||||| ||| |||||||||||||||||||| |||| |||||||||||||||| ||||||||||||||    
28616785 agggggtaggtctaaaactgctatttctctgcgttttttggataataaaatggggggtaggacgaaaattgcaacaaaaatgataattgaaggaccgttt 28616686  T
106 tgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| | |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
28616685 tgttctgttttaaaagggcaagaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 28616616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 43058504 - 43058336
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||| |||||||||||||||    
43058504 agggggtaggtctaaaactgtcatttctctacgtttttggagaataaaatggggggtagaacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 43058405  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| |||| |||||||||  ||||| |||||||||||||||| |||||||||||||||    
43058404 gttctgttttaaaaaggcaggaccagtttagtgagttggccaaaacacgaggatcaaaagtgtaattaa 43058336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 3025636 - 3025466
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |||||| ||||||||||||||||||||| |||||||||||||||    
3025636 agggggtaggtctaaaactgtcatttctttgcgttttttgagaataaaatggggg-taggacgaaaaatgcaacaaaaatgatacttgaaggaccgtttt 3025538  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||| | ||||||||| ||| |||||||||| |||||||||||||||||||||||||||| |||||| |||||    
3025537 gttctgttttaaaagagcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaaatgtaatcaaacc 3025466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 9 - 176
Target Start/End: Original strand, 8425736 - 8425903
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||||||||||||| ||||||||| |||||||    
8425736 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaattgggggtaagacgaaaaatgcaacaaaaatgataattgaaggacagttttgt 8425835  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaa 176  Q
    | ||||||||||||||| ||||| |||| ||||||| ||||||||| || ||||||||||||||||||    
8425836 tctattttaaaagggcaggaccaatttcgtgagtagaccaaaacacaagaaccaaaagtgtaattaaa 8425903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 13 - 175
Target Start/End: Complemental strand, 26538262 - 26538100
Alignment:
13 taggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttata 112  Q
    ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |||||| |     
26538262 taggtctaaaactgttatttctctgtgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgctttgttctg 26538163  T
113 ttttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||||||  ||||||||| |||||| |||||||||||||||||||||||||||||||    
26538162 ttttaaaagggcagaaccagtttcgtgagtaagccaaaacacgaggaccaaaagtgtaattaa 26538100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 26538454 - 26538621
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttg 107  Q
    |||||||||||||||||||||||||||||||||| ||| |  | ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||    
26538454 ggggtaggtctaaaactgtcatttctctgcgtttctggggtttgaaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttg 26538553  T
108 ttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    || | |||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
26538554 ttctgttttaagagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 26538621  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 40815506 - 40815348
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaa-tggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  ||||| | || |||||||| ||||||||||||||||||||| |||||| ||||||||||||| ||||    
40815506 ctaaaactgtcatttctctgcgtttctggagtttaaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaagaaccgttttgttatgtttt 40815407  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
40815406 aaaagggcaagaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 40815348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 22 - 175
Target Start/End: Complemental strand, 7446497 - 7446345
Alignment:
22 aactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaag 121  Q
    |||||||||||||||||||||||||||||||||||||||| || ||| |||||||||| |||||||||| ||||| |||||||||||| | |||||||||    
7446497 aactgtcatttctctgcgtttttggagaataaaatggggg-tatgacgaaaaatgcaataaaaatgataattgaatgaccgttttgttctgttttaaaag 7446399  T
122 ggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| ||||| |||||||||||| |||||||||||||| |||||||||||||||    
7446398 ggcaggaccaatttcatgagtagaccaaaacacgaggatcaaaagtgtaattaa 7446345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 18450991 - 18450833
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| |||||||||| |||||||||| |||||||||||||||||| | ||||    
18450991 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggactaaaaatgcaaaaaaaatgataattgaaggaccgttttgttctgtttt 18450892  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||  |||||||||| ||||||||||||||||||||||||||||||||||||||    
18450891 aaaagggctggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 18450833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 37 - 175
Target Start/End: Complemental strand, 20444890 - 20444752
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| ||||||||||||||||||| |||| ||||||||||||||||  ||||||||||||||||| | ||||||||||||| ||||||||||    
20444890 gcgtttttggaggataaaatggggggtaggacgaaaactgcaacaaaaatgataactgaaggaccgttttgttctgttttaaaagggcaggaccagtttc 20444791  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     ||||| ||||||||||||||||||||||||||||||||    
20444790 gtgagttggccaaaacacgaggaccaaaagtgtaattaa 20444752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 22374709 - 22374867
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||| ||| | |||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
22374709 ctaaaactgtcatttctctgcatttctagagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 22374808  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||    
22374809 aaaagggcaagaccaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 22374867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 7446730 - 7446888
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||||||||||||||||||||||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
7446730 ctaaaactgtcatttctctgcgtttttggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 7446829  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| |||||| | ||||||||||||| ||||| |||||||||    
7446830 aaaagggcaggaccagtttcgtgagtaaggcaaaacacgaggatcaaaaatgtaattaa 7446888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 40027524 - 40027685
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| |||||| |||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| ||||| |||||||||||| | ||||    
40027524 ctaaaactgccatttcactgcgtttatggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaagaccgttttgttctgtttt 40027623  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||||||||| ||||| |||| |||||||||||||||||||||||||||||||||||||||||    
40027624 aaaagggcaggaccaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 40027685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 37 - 175
Target Start/End: Original strand, 35781067 - 35781205
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| |||||||||||| |||||| ||||||||||||||||||||| ||||||||  |||||||| | ||||||||||||| ||||| ||||    
35781067 gcgtttttggaggataaaatgggggttaggacgaaaaatgcaacaaaaatgataattgaaggatagttttgttctgttttaaaagggcatgaccattttc 35781166  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     |||||||||||||||||||||| |||||||||||||||    
35781167 gtgagtaggccaaaacacgaggatcaaaagtgtaattaa 35781205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 11090904 - 11091062
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||| |||||||| ||||||||| |||||  | ||||| || | |||||| |||||| |||||| ||||||| |||||||||||||||||| | ||||    
11090904 ctaaaattgtcatttatctgcgtttctggagtttgaaaataggagataggacgaaaaatacaacaataatgataattgaaggaccgttttgttctgtttt 11091003  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
11091004 aaaagggcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 11091062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 37 - 175
Target Start/End: Complemental strand, 35779849 - 35779711
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||  ||||||| | |||||||| |||| ||||| ||||    
35779849 gcgtttttggaggataaaatggggggtaggacaaaaaatgcaacaaaaatgataattgaaggacaattttgttctgttttaaaatggcaggaccattttc 35779750  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     |||||| | |||||||||||||||||||||||||||||    
35779749 gtgagtatgtcaaaacacgaggaccaaaagtgtaattaa 35779711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 171
Target Start/End: Original strand, 239736 - 239890
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||||||||||| |||||  | ||||| || |||| ||| ||||| ||||||||||||||| |||||||||| ||||||| | ||||    
239736 ctaaaactgccatttctctgcgtttctggagtttgaaaataggaggtatgacgaaaaacgcaacaaaaatgataattgaaggaccattttgttctgtttt 239835  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaa 171  Q
    ||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||    
239836 aaaagggcaggaccaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaa 239890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 37 - 175
Target Start/End: Original strand, 20440436 - 20440573
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| ||||| |||||| |||||| |||| ||||||||||||||||  |||| |||||||||||| | ||||||||||||| ||||||||||    
20440436 gcgtttttggaggataaa-tgggggataggacgaaaactgcaacaaaaatgataactgaatgaccgttttgttctgttttaaaagggcaggaccagtttc 20440534  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     ||||| ||||||||||||||||||||||||||||||||    
20440535 gtgagttggccaaaacacgaggaccaaaagtgtaattaa 20440573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 28616998 - 28617156
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||  |||||||||||||| |||||  | ||||| || |||| ||| ||||||||||||||||||||| |||||||||| ||||||| | ||||    
28616998 ctaaaactgctatttctctgcgtttctggagtttgaaaataggaggtaagacgaaaaatgcaacaaaaatgataattgaaggaccattttgttctgtttt 28617097  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||| ||  ||||||||| ||||||||||||||||||||||||||||||||||||||    
28617098 aaaaggacagaaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 28617156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 43058717 - 43058874
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||| ||||| |||||||||| ||||||| | ||||    
43058717 ctaaaactgccatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaa-tgataattgaaggaccattttgttctgtttt 43058815  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||| |||||||||| |||||||||||||||||||||| |||||||||||||||    
43058816 aaaagagcaggaccagtttcgtgagtaggccaaaacacgaggatcaaaagtgtaattaa 43058874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 52 - 175
Target Start/End: Original strand, 1978528 - 1978651
Alignment:
52 aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaa 151  Q
    ||||| || |||||||| ||||||||||||||||||||| ||||||||| |||||||| | ||||||||||||| ||||| |||| ||||||||||||||    
1978528 aaaataggaggtaggacaaaaaatgcaacaaaaatgataattgaaggactgttttgttctgttttaaaagggcaggaccaatttcgtgagtaggccaaaa 1978627  T
152 cacgaggaccaaaagtgtaattaa 175  Q
    ||| ||||||||||||||||||||    
1978628 cacaaggaccaaaagtgtaattaa 1978651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 19 - 176
Target Start/End: Complemental strand, 8425514 - 8425357
Alignment:
19 taaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    |||||||||||||||||||| ||| |||||  | ||||| || |||||||| |||||||||||| |||||||| |||||| ||||||||||| | |||||    
8425514 taaaactgtcatttctctgcatttctggagtttgaaaataggaggtaggacgaaaaatgcaacacaaatgataattgaag-accgttttgttctgtttta 8425416  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaa 176  Q
    ||| || ||||||| |||| ||||||||||||||||| |||||||||||||||||||||    
8425415 aaaaggtaagaccaatttcgtgagtaggccaaaacacaaggaccaaaagtgtaattaaa 8425357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 14432525 - 14432683
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| | |||  | ||||| || |||||||  ||||||||||||||||| ||| |||||| ||| |||| || | ||||    
14432525 ctaaaactgtcatttctctgcgtttctagagtttgaaaataggaggtaggatgaaaaatgcaacaaaaataataattgaagaaccattttattctgtttt 14432624  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||| ||||||||||||||||||||||||||||||||||||||| |||||||||    
14432625 aaaatggcatgaccagtttcatgagtaggccaaaacacgaggaccaaaaatgtaattaa 14432683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 61 - 175
Target Start/End: Original strand, 28847123 - 28847237
Alignment:
61 ggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggac 160  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||||||| ||| |||||||||| ||||||| |||||||||||||||    
28847123 ggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttttgttttaaaagagcaggaccagtttcgtgagtagaccaaaacacgaggac 28847222  T
161 caaaagtgtaattaa 175  Q
    ||||| |||||||||    
28847223 caaaaatgtaattaa 28847237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 36 - 175
Target Start/End: Complemental strand, 15551641 - 15551502
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagttt 135  Q
    ||||||||||||| ||||||||| |||| |||| |||||||||||||||||||||  ||||||||  ||||||| | |||||||| |||| ||||| |||    
15551641 tgcgtttttggaggataaaatggagggttggacgaaaaatgcaacaaaaatgataactgaaggacatttttgttttgttttaaaaaggcatgaccatttt 15551542  T
136 catgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||||||  ||||||||||||||||||||||||||||||    
15551541 cgtgagtaaaccaaaacacgaggaccaaaagtgtaattaa 15551502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 37 - 175
Target Start/End: Complemental strand, 8972378 - 8972240
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| ||||||| |||||||| || ||||||||||||||||||||| ||||| |||  ||||||| | |||| |||||||| ||||| ||||    
8972378 gcgtttttggaggataaaatagggggtagaacgaaaaatgcaacaaaaatgataattgaatgacaattttgttctgttttgaaagggcatgaccattttc 8972279  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     |||| | |||||||||||||||||||||||||||||||    
8972278 gtgagcatgccaaaacacgaggaccaaaagtgtaattaa 8972240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 19 - 175
Target Start/End: Original strand, 3025848 - 3026003
Alignment:
19 taaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    |||||||||||||||||||| ||| |||||  | ||||| || |||||||| ||||||||||||||||| ||| |||||||||||||||||| | |||||    
3025848 taaaactgtcatttctctgcatttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaataataattgaaggaccgttttgtt-tgtttta 3025946  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||  |||| |||| |||||| ||||||||||||||||||||| |||||||||    
3025947 aaagggcagaaccaatttcgtgagtaagccaaaacacgaggaccaaaa-tgtaattaa 3026003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 38 - 175
Target Start/End: Original strand, 15552459 - 15552595
Alignment:
38 cgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttca 137  Q
    |||||||||||   ||||||| ||||||||| |||||| |||||||||||||| ||||| |||  ||||||| | ||||||||||||  || || ||||     
15552459 cgtttttggagggcaaaatggagggtaggacgaaaaatacaacaaaaatgataattgaatgacaattttgttctgttttaaaagggc-ggatcattttcg 15552557  T
138 tgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||||||||  | ||||||||||||||||||    
15552558 tgagtaggccaaaacattatgaccaaaagtgtaattaa 15552595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 28143405 - 28143572
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||| |||||   ||||| ||  ||||||| |||| ||||| ||| ||||||||| | ||||  ||||    
28143405 agggggtaggtctaaaactgtcatttctctgcgtttctggagttgaaaataggacgtaggactaaaactgcaa-aaacatgatagtttagggacgatttt 28143503  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||  |||| |||  |||| ||||| |||| ||||  || |||||  ||||||||||||||| ||||||    
28143504 gttcgatttgaaagaggcaggaccattttcgtgagctggtcaaaatgcgaggaccaaaagtgaaattaa 28143572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 38 - 178
Target Start/End: Original strand, 3824114 - 3824254
Alignment:
38 cgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttca 137  Q
    ||||||||||| |||||||||||| ||| || |||| ||||| ||| |||||||   | | || ||||||||  |||| ||||||||| ||||| ||||     
3824114 cgtttttggaggataaaatgggggttagaactaaaattgcaaaaaacatgatagcatatgaactgttttgttcgatttaaaaagggcatgaccaatttcg 3824213  T
138 tgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||||| ||  ||||  ||| |||||||||| ||||||||||    
3824214 tgagttggttaaaatgcgatgaccaaaagtataattaaacc 3824254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 175
Target Start/End: Original strand, 31797166 - 31797320
Alignment:
20 aaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaa 119  Q
    ||||||||||||||||||||||| | |||   ||||| || |||||||| |||| ||||| ||| || |||||| | |||| ||||||||  |||| |||    
31797166 aaaactgtcatttctctgcgtttctagagttgaaaataggaggtaggactaaaactgcaaaaaacat-atagtttagggacggttttgttcgatttgaaa 31797264  T
120 agggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
      |||| ||||| |||| ||||  || |||||   |||||||||||||||||||||    
31797265 gaggcatgaccattttcgtgagctggtcaaaatgtgaggaccaaaagtgtaattaa 31797320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 32)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 19830591 - 19830420
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
19830591 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 19830492  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||| | |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
19830491 gttctgttttaaaagggcaagaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 19830420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 37786938 - 37786770
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
37786938 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 37786839  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||    
37786838 gttatgttttaaaagggcaggaccagtttcgtaagtaggccaaaacacgaggaccaaaagtgtaattaa 37786770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 19590696 - 19590528
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||  ||||||||||||||||||||| |||||||||||||||    
19590696 agggggtaggtctaaaactgtcatttctctgggtttttggagaataaaatggggggtaggatgaaaaatgcaacaaaaatgataattgaaggaccgtttt 19590597  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
19590596 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 19590528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 7 - 188
Target Start/End: Original strand, 2659214 - 2659395
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||| ||||| |||||||||    
2659214 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggatgaaaaatgcaacaaaaatgataattgaatgaccgtttt 2659313  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacccaacttttat 188  Q
    ||| | |||||||||||||||||||||||||||| ||||||||||| |||||||||||| ||||||||| || || ||||||    
2659314 gttctgttttaaaagggcaagaccagtttcatgaataggccaaaacgcgaggaccaaaattgtaattaagcctaatttttat 2659395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 32004988 - 32005156
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| || ||||||||||||    
32004988 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggagtaggacgaaaaatgcaacaaaaatgataattaaaggaccgtttt 32005087  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| ||||||||||||||| |||||||||| |||||| ||||||||| |||||||||||||||||||||    
32005088 gttctattttaaaagggcatgaccagtttcgtgagtatgccaaaacatgaggaccaaaagtgtaattaa 32005156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 10 - 175
Target Start/End: Complemental strand, 38858811 - 38858646
Alignment:
10 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||    
38858811 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgataattgaatgaccgttttgtt 38858712  T
110 atattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     | ||||||||| ||| |||||||||| |||||| ||||||||||||||||||||||||| |||||    
38858711 ctgttttaaaagagcaggaccagtttcgtgagtatgccaaaacacgaggaccaaaagtgttattaa 38858646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 7 - 178
Target Start/End: Original strand, 29100225 - 29100396
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||    
29100225 agggggtaggtctaaaactgttatttctctgcgtttttggagaataaaatggggggtaggacaaaaaatgcaacaaaaatgataattgaaagaccgtttt 29100324  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||| | ||||||||||||| ||||| |||  ||||||| |||||||||||||||||||||||||||||||||    
29100325 gttctgttttaaaagggcaggaccaattttgtgagtagaccaaaacacgaggaccaaaagtgtaattaaacc 29100396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 4641611 - 4641440
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||| |||||||||||| |||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||    
4641611 agggggcaggtctaaaactatcatttctctgcatttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaatgaccgtttt 4641512  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||||| ||| ||||| ||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||    
4641511 gttatgtttcaaaagagcaggaccagtttcgtgagtaagccaaaacacgaggaccaaaagtgtaattaaacc 4641440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 35289275 - 35289443
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||| | |||||||||||||||| ||||||||||||||||||| ||| ||||||||||| ||||||||| |||||||||||||||    
35289275 agggggtaggtctaaaactattatttctctgcgtttttagagaataaaatggggggtatgacgaaaaatgcaaccaaaatgataattgaaggaccgtttt 35289374  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||    
35289375 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggatcaaaagtgtaattaa 35289443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 11 - 175
Target Start/End: Original strand, 34534169 - 34534333
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtta 110  Q
    |||||||||||||||||||||||||||  ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||     
34534169 ggtaggtctaaaactgtcatttctctgtttttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttc 34534268  T
111 tattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||||||| ||||| || ||||||| |||||||||||||||||||| ||||||||| |||||||    
34534269 tgttttaaatgggcaggatcagtttcgtgagtaggccaaaacacgagaaccaaaagtataattaa 34534333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 9 - 172
Target Start/End: Original strand, 23953105 - 23953268
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    |||||| |||||||||||| |||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||||||||||    
23953105 ggggtatgtctaaaactgttatttctctgcgtttttggagaataaaatggggggtatgacgaaaaatgcaacaaaaatgataattgaaggaccgttttgt 23953204  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaat 172  Q
    | | |||| |||||||  |||||||||| |||||||  ||||||||||||||||||| ||||||    
23953205 tctgttttgaaagggcgggaccagtttcgtgagtagatcaaaacacgaggaccaaaaatgtaat 23953268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 9 - 178
Target Start/End: Original strand, 4478076 - 4478245
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| ||| || ||| ||||||||||||||||||||| |||||||||  | || |    
4478076 ggggtaggtctaaaactgttatttctctgcgtttttggagaataaaatgagggataagacgaaaaatgcaacaaaaatgataattgaaggacaatgttat 4478175  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    | | ||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||| |||||||    
4478176 tctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggatcaaaagtgtacttaaacc 4478245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 19590909 - 19591067
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
19590909 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 19591008  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| |||||||||||||||||||| |||||||||||||||||    
19591009 aaaagggcaggaccagtttcgtgagtaggccaaaacacgagtaccaaaagtgtaattaa 19591067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 2659000 - 2658842
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| |||||||||||||||||||||  | ||||| || |||| ||| ||||||||||||||||||||| |||||||||| ||||||| ||||||    
2659000 ctaaaactgccatttctctgcgtttttggagtttgaaaataggaggtatgacgaaaaatgcaacaaaaatgataattgaaggaccattttgttctatttt 2658901  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||    
2658900 aaaagggcaggaccagtttcgtgagtaggccaaaacacgaggacaaaaagtgtaattaa 2658842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 38859025 - 38859183
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||| |||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| | |||||||||||||||| | ||||    
38859025 ctaaaactatcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataatggaaggaccgttttgttctgtttt 38859124  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||    
38859125 aaaagggcaggaccaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 38859183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 28583577 - 28583442
Alignment:
40 tttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatg 139  Q
    ||||||||| ||||||||||||||||||| |||||||||| |||||||||| ||||||||| ||||| |||| |||||||||||||  |||| | |||||    
28583577 tttttggaggataaaatggggggtaggacgaaaaatgcaataaaaatgataattgaaggacagttttattatgttttaaaagggcagaaccaatctcatg 28583478  T
140 agtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||||||||||||||||||||||||||||    
28583477 agtaggccaaaacacgaggaccaaaagtgtaattaa 28583442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 19830804 - 19830961
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||||||||||||| |||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||| ||||||||||||| ||||    
19830804 ctaaaactgtcatttctctgtgtttctggagtttgaaaataggaggtaggac-aaaaatgcaacaaaaatgataattgaagtaccgttttgttatgtttt 19830902  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||| || |||||||||  ||||||||||||||||||||||||||||||||||||||    
19830903 aaaaggacaggaccagttttgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 19830961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 32004774 - 32004617
Alignment:
19 taaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    |||||||||||||||||||||||| |||||  | ||||| || |||||| | ||||||||||||||||||||| |||||||||| ||||||| | |||||    
32004774 taaaactgtcatttctctgcgtttctggagtttgaaaataggaggtagggcgaaaaatgcaacaaaaatgataattgaaggaccattttgttctgtttta 32004675  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||| || || |||| ||||||||||||||||||||||||||||||||||||||    
32004674 aaagggcaggatcaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 32004617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 20 - 175
Target Start/End: Original strand, 37787153 - 37787309
Alignment:
20 aaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaa 118  Q
    ||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||| ||||||||||| |  |||||    
37787153 aaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaagaaccgttttgttctgatttaa 37787252  T
119 aagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| ||| |||||||||| |||||||||||||||||||||||||||||| |||||||    
37787253 aagagcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtataattaa 37787309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 34533952 - 34533794
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||| ||||||||||||||||||||||||  | ||||| || ||||||||  |||||||||||||||||||| ||||| |||| |||| || | ||||    
34533952 ctaaaagtgtcatttctctgcgtttttggagtttgaaaataggaggtaggacggaaaatgcaacaaaaatgataattgaatgaccattttattctgtttt 34533853  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
34533852 aaaagagcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 34533794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 35289063 - 35288906
Alignment:
19 taaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    ||||||||||||||||||| |||| |||||  | |||||  |  ||||||| ||||||||||||||||||||| |||||||||| ||||||| | |||||    
35289063 taaaactgtcatttctctgtgtttctggagtttgaaaatatgaagtaggacgaaaaatgcaacaaaaatgataattgaaggaccattttgttctgtttta 35288964  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||| |||||||||| |||||||||||||| |||| ||||||||||||||||||    
35288963 aaagggcaggaccagtttcgtgagtaggccaaaatacgatgaccaaaagtgtaattaa 35288906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 18 - 165
Target Start/End: Complemental strand, 29100011 - 29099863
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||| ||| ||||| ||| |  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
29100011 ctaaaactgtcatttatctacgtttctggggtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 29099912  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaa 165  Q
    ||||||||| || ||||||| ||||||||||||||||||||||||||||    
29099911 aaaagggcaggatcagtttcgtgagtaggccaaaacacgaggaccaaaa 29099863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 36 - 175
Target Start/End: Complemental strand, 38161093 - 38160954
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagttt 135  Q
    ||||||||||||| ||||||||||| ||||||| ||||||||||||||||| ||| |||||||||  ||||||| | ||||||||||||| ||  | |||    
38161093 tgcgtttttggaggataaaatggggagtaggacgaaaaatgcaacaaaaataataattgaaggacaattttgttctgttttaaaagggcaggattatttt 38160994  T
136 catgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||||||||||||||| ||||||||||||||||||||||    
38160993 cgtgagtaggccaaaacccgaggaccaaaagtgtaattaa 38160954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 4641828 - 4641983
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| | |||  | ||||| ||  ||||||| ||| ||||||||||||||||| |||||||||||||||||| | ||||    
4641828 ctaaaactgtcatttctctgcgtttctagagtttgaaaataggacgtaggacgaaatatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 4641927  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||| || |||||||    ||||||||||||||||||||||||||||||||||||||    
4641928 aaaaggacaggaccagt---gtgagtaggccaaaacacgaggaccaaaagtgtaattaa 4641983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 23952892 - 23952733
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||| |||||||||||||||| ||| |  | ||||| |  |||||||| ||||||||||| ||||||||| |||||||||||||||||| | ||||    
23952892 ctaaaactatcatttctctgcgtttctggggtttgaaaatagaaggtaggacgaaaaatgcaaccaaaatgataattgaaggaccgttttgttctgtttt 23952793  T
117 aaaagggcaagaccagtttcatgagta-ggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| ||||| |||| |||||| || |||||||||||||||||||||||||||||    
23952792 aaaagggcatgaccaatttcgtgagtagggtcaaaacacgaggaccaaaagtgtaattaa 23952733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 37 - 175
Target Start/End: Original strand, 28584326 - 28584464
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| ||||||||||||||| ||| |||||| |||||||||||||| |||||||||  ||||||| | |||||||||| || ||||| ||||    
28584326 gcgtttttggaggataaaatggggggtaagacgaaaaatacaacaaaaatgataattgaaggacaattttgttctgttttaaaaggacatgaccaatttc 28584425  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     ||| ||||||||| ||||||||| ||||||||||||||    
28584426 gtgaataggccaaagcacgaggacgaaaagtgtaattaa 28584464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 9 - 44
Target Start/End: Original strand, 32427397 - 32427432
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgttttt 44  Q
    ||||||||||||||||||||||||||||||||||||    
32427397 ggggtaggtctaaaactgtcatttctctgcgttttt 32427432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 7 - 93
Target Start/End: Original strand, 35579261 - 35579347
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagtt 93  Q
    ||||||||||||||||||||| ||||| |||||||||| |||   ||||| || |||| ||| |||| ||||| ||| |||||||||    
35579261 agggggtaggtctaaaactgttatttccctgcgtttttagagttgaaaataggaggtatgactaaaactgcaaaaaacatgatagtt 35579347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 34595158 - 34595315
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaat-ggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||| ||||||| |||||   |||||  |||||||| || |||| ||||| ||| ||||||||| | ||||  |||||||  ||||     
34595158 ctaaaactgtcatttctgtgcgtttctggagttgaaaataagggggtagcactaaaactgcaa-aaacatgatagtttagggacgattttgttcgattta 34595256  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||   ||| ||||| |||| ||||| || |||||   |||||||||||||||||||||    
34595257 aaagatgcaggaccattttcgtgagttggtcaaaatgtgaggaccaaaagtgtaattaa 34595315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 93
Target Start/End: Complemental strand, 35579069 - 35578983
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagtt 93  Q
    ||||| ||||||||||| |||||||||||||||||| |||||   ||||| ||  ||||||  |||| ||||| ||| |||||||||    
35579069 aggggataggtctaaaaatgtcatttctctgcgtttctggagttgaaaataggatgtaggattaaaactgcaaaaaacatgatagtt 35578983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 9393894 - 9393739
Alignment:
19 taaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaa 118  Q
    ||||||||||||||| ||| |||| |||||   ||||| || |||||||| ||||  |||| ||| |||||||||  ||||| ||||||||  |||| ||    
9393894 taaaactgtcatttcactgtgtttctggagttgaaaataggaggtaggactaaaacagcaaaaaacatgatagtt-taggacggttttgttcgatttgaa 9393796  T
119 aagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |  |||||||| | |||| ||||  |  |||||  |||||| |||||||||||||||    
9393795 agaggcaagacaattttcgtgagctgatcaaaatgcgaggatcaaaagtgtaattaa 9393739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 175
Target Start/End: Complemental strand, 49064109 - 49064037
Alignment:
103 ttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||| ||||| |||  ||||| |||| |||| ||||  || ||||| |||||||||||||||||||||||    
49064109 ttttgttctatttgaaagaggcaataccattttcgtgagctggtcaaaatacgaggaccaaaagtgtaattaa 49064037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0295 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: scaffold0295
Description:

Target: scaffold0295; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 4964 - 4796
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
4964 agggggtaggtctaaaactgttatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 4865  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
4864 gttctgttttaaaagggcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 4796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0295; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 5179 - 5333
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||| ||||||||| |||||  | ||||| ||    ||||| ||||||||||||||||||||| |||||  |||||||| || | ||||    
5179 ctaaaactgtcatttttctgcgtttctggagtttgaaaatagg----aggacgaaaaatgcaacaaaaatgataattgaattaccgttttattctgtttt 5274  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||| ||||||||||||| ||| ||||||||||||||||||||||||||||||||||    
5275 aaaaggacaagaccagtttcgtgactaggccaaaacacgaggaccaaaagtgtaattaa 5333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 141; Significance: 5e-74; HSPs: 37)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 10900304 - 10900472
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
10900304 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 10900403  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||    
10900404 gttctgttttaaaagggcatgaccagtttcgtgagtaggccaaaatacgaggaccaaaagtgtaattaa 10900472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 20741271 - 20741103
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||    
20741271 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgatatttgaaggaccatttt 20741172  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
20741171 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 20741103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 1149805 - 1149974
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttt-tggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttt 105  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||    
1149805 agggggtaggtctaaaactgtcatttctctgcgttttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatggtaattgaaggaccgttt 1149904  T
106 tgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| ||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||    
1149905 tgttctattttaaaagggcatgaccagtttcatgagtaggctaaaacacgaggaccaaaagtgtaattaa 1149974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 15828015 - 15828183
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
15828015 agggggtaggtctaaaactgttatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 15828114  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||    
15828115 gttttgttttaaaagggtatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 15828183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 10 - 175
Target Start/End: Complemental strand, 18257305 - 18257140
Alignment:
10 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||    
18257305 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtatgacgaaaaatgcaacaaaaatgataattgaaggaccgttttgtt 18257206  T
110 atattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     | ||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||    
18257205 ctgttttaaaagggcaggaccagtttcgtgagtatgccaaaacacgaggaccaaaagtgtaattaa 18257140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 11276956 - 11277124
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||    
11276956 agggggtaggtctaaaactgtcatttctcttcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaagaaccgtttt 11277055  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| |||||| |||||||||||||||||||||||||||||||    
11277056 gttctgttttaaaagggcaggaccagtttcgtgagtaagccaaaacacgaggaccaaaagtgtaattaa 11277124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 31470692 - 31470858
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
31470692 ggggtagatctaaaattgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgt 31470791  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | | |||||||||||||  ||||||||| ||||||||| ||||||| ||||||||||||||||||||    
31470792 tctgttttaaaagggcagaaccagtttcgtgagtaggctaaaacacaaggaccaaaagtgtaattaa 31470858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 2319832 - 2319675
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    |||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||    
2319832 ctaaaactatcatttctctgcgtttctggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttta 2319733  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||| |||||||||| |||||||||||||||||||||||||||| |||||||||    
2319732 aaagggcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaaatgtaattaa 2319675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 12935531 - 12935699
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||    
12935531 agggggtaggtctaaaactgtcatttctctgtgtttatggagaataaaatggggggtaggacgaaaaatgtaacaaaaatgataattgaaggaccgtttt 12935630  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||| || |||| |||||||||| |||||| |||||||||||||||||||||||||||||||    
12935631 gttctgttttataaaggcaggaccagtttcgtgagtacgccaaaacacgaggaccaaaagtgtaattaa 12935699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 11445158 - 11444990
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||| |||||| ||||||||||||| ||||||||| ||||||||||||||||||||| |||||||||| ||||    
11445158 agggggtaggtctaaaactgtcatttctctgtgtttttagagaataaaatggagggtaggacgaaaaatgcaacaaaaatgataattgaaggaccatttt 11445059  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     || | ||||||| ||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||    
11445058 attctgttttaaaggggcaggaccagcttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 11444990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 28472807 - 28472640
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||| |||| ||||    
28472807 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggg-taggacgaaaaatgcaacaaaaatgataattgaatgaccatttt 28472709  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| |||| ||||| |||| ||||| ||||||||||||||||||||||||||||||||    
28472708 gttctgttttaaaatggcaggaccactttcgtgagttggccaaaacacgaggaccaaaagtgtaattaa 28472640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 29859996 - 29859829
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| ||||| |||| ||||    
29859996 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggg-taggacgaaaaatgcaacaaaaatgataattgaatgaccatttt 29859898  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| |||| ||||| |||| ||||| ||||||||||||||||||||||||||||||||    
29859897 gttctgttttaaaatggcaggaccactttcgtgagttggccaaaacacgaggaccaaaagtgtaattaa 29859829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 7 - 177
Target Start/End: Original strand, 2322593 - 2322762
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||| |||||||||||||||||||||||| ||||| ||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||    
2322593 agggggaaggtctaaaactgtcatttctctgtgtttt-ggagaataaaatgaggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 2322691  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaac 177  Q
    ||| | |||||||| |||||||| |||||| ||||||| ||||||||||| ||||||||||||||||||||    
2322692 gttctgttttaaaaaggcaagactagtttcgtgagtagaccaaaacacgaagaccaaaagtgtaattaaac 2322762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 9 - 176
Target Start/End: Complemental strand, 10900109 - 10899941
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttg 107  Q
    |||||||||||||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| ||||||||||||||||    
10900109 ggggtaggtctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttg 10900010  T
108 ttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaa 176  Q
    || | ||||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||||||||    
10900009 ttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgatgaccaaaagtgtaattaaa 10899941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 19 - 175
Target Start/End: Original strand, 18505305 - 18505461
Alignment:
19 taaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaa 118  Q
    |||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||| ||||||    
18505305 taaaactgtcatttctcttcgttgttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggactgttttgttatgttttaa 18505404  T
119 aagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||| || ||||||| ||||||| |||||||||||||||||||||| |||||||    
18505405 aagggcaggatcagtttcgtgagtagaccaaaacacgaggaccaaaagtataattaa 18505461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 12935318 - 12935160
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
12935318 ctaaaactgtcatttctctgcgtttatggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 12935219  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
12935218 aaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 12935160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 11 - 175
Target Start/End: Complemental strand, 23074155 - 23074002
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtta 110  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||           ||| ||||||||||||||||||     
23074155 ggtaggtctaaaactgttatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatg-----------ataattgaaggaccgttttgttc 23074067  T
111 tattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
23074066 tattttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 23074002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 23075512 - 23075670
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaa-tggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||| |||||||||  ||||| | || ||||| || ||||||||||||||||||||| |||||||||||||||||| | ||||    
23075512 ctaaaactgtcatttctctgcatttttggagtttaaaaataggaggtagaacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 23075611  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
23075612 aaaagggcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 23075670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 4811535 - 4811375
Alignment:
15 ggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatt 114  Q
    ||||||||||||| |||| |||||||||||| |||||||||||||||||| ||| ||||||| ||||||||||||| ||||||||||||||| || ||||    
4811535 ggtctaaaactgttatttatctgcgtttttgaagaataaaatggggggtaagacgaaaaatgaaacaaaaatgataattgaaggaccgttttattctatt 4811436  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||| |||||||||| ||||||| |||||| ||  |||||||||||||||||||    
4811435 ttaaaagggcatgaccagtttcgtgagtagaccaaaatactgggaccaaaagtgtaattaa 4811375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 11445371 - 11445543
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| | |||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
11445371 ctaaaactgtcatttctctgcgtttctagagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 11445470  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacccaacttttatt 189  Q
    |||| |||| |||||||||| |||||||||||||||||||||||||||||||||||||| || || |||||||    
11445471 aaaaaggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaagcctaaattttatt 11445543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 22219737 - 22219895
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||||||||||||| |||| |||||  | ||||| || ||||| || ||||||||||||||||||||| |||||||||||||||||| | ||||    
22219737 ctaaaactgtcatttctctgagtttctggagtttgaaaataggaggtagaacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 22219836  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
22219837 aaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 22219895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 18505080 - 18504920
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||| | ||| | |||  | ||||| || |||||||| ||||||| ||||||||||||| |||||| ||||||||||| | ||||    
18505080 ctaaaactgtcatttctctacatttctagagtttgaaaataggaggtaggacgaaaaatgaaacaaaaatgataattgaagaaccgttttgttctgtttt 18504981  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaac 177  Q
    |||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||||    
18504980 aaaaaggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaac 18504920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 9 - 175
Target Start/End: Complemental strand, 11276760 - 11276593
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttg 107  Q
    |||||||| |||||||||||||||||||||||||||||||  | ||||| || |||||||| ||||||| ||||||||||| | |||||||||| |||||    
11276760 ggggtaggcctaaaactgtcatttctctgcgtttttggagtttgaaaataggaggtaggacgaaaaatgaaacaaaaatgacaattgaaggaccattttg 11276661  T
108 ttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    || | ||||||||||| | || ||||||||||||||| |||||||||| |||| ||| ||||||||||    
11276660 ttctgttttaaaagggtaggatcagtttcatgagtagaccaaaacacgcggactaaacgtgtaattaa 11276593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 25 - 175
Target Start/End: Complemental strand, 15827794 - 15827641
Alignment:
25 tgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgt--tttgttatattttaaaag 121  Q
    |||||||| ||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||||||||||||||||  |||||||| |||||||||    
15827794 tgtcatttttctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgatagttgaaggaccgtaatttgttatgttttaaaag 15827695  T
122 ggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||  ||||||||| |||||| |||||||||||||||||||||||||||||||    
15827694 gacagaaccagtttcgtgagtaagccaaaacacgaggaccaaaagtgtaattaa 15827641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 31470476 - 31470318
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||| ||| ||||| ||| |||||||| | ||||    
31470476 ctaaaactgccatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaataataattgaatgactgttttgttctgtttt 31470377  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||| |||||||||| |||||||||||||||||||||| |||||||||||||||    
31470376 aaaagagcatgaccagtttcgtgagtaggccaaaacacgaggatcaaaagtgtaattaa 31470318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 20741485 - 20741646
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaa---tgatagttgaaggaccgttttgttatat 113  Q
    |||||| |||||||||||||||||| |||||  | ||||| || |||||||| |||||||||| |||||   ||||| |||||||||||||||||| | |    
20741485 ctaaaattgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaaaaaaaaaaatgataattgaaggaccgttttgttctgt 20741584  T
114 tttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||||| || ||||||| |||||||||||||||||||||||||| |||||||||||    
20741585 tttaaaagggcaggatcagtttcgtgagtaggccaaaacacgaggaccaagagtgtaattaa 20741646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 61 - 175
Target Start/End: Original strand, 18257565 - 18257679
Alignment:
61 ggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggac 160  Q
    |||||||| ||||||| ||||||||| ||| |||||||||||||||||| | ||||||||||||| |||||||||| |||||||| ||||||||||||||    
18257565 ggtaggacgaaaaatgtaacaaaaataataattgaaggaccgttttgttctgttttaaaagggcaggaccagtttcgtgagtaggtcaaaacacgaggac 18257664  T
161 caaaagtgtaattaa 175  Q
    ||||||| |||||||    
18257665 caaaagtataattaa 18257679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 36 - 175
Target Start/End: Complemental strand, 29033577 - 29033437
Alignment:
36 tgcgtttttggag-aataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtt 134  Q
    ||||||||||||| || ||||||||||||||||  |||  ||||||||||||||||  |||||||| |||||||| | ||||||||||||| ||||| ||    
29033577 tgcgtttttggaggaaaaaaatggggggtaggatgaaatgtgcaacaaaaatgataactgaaggacagttttgttctgttttaaaagggcaggaccaatt 29033478  T
135 tcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    || |||| ||||||||| |||||||||||||||||||||||    
29033477 tcgtgagcaggccaaaatacgaggaccaaaagtgtaattaa 29033437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 70 - 175
Target Start/End: Original strand, 4811693 - 4811798
Alignment:
70 aaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgt 169  Q
    ||||||||||||||||||||| |||||||||||||||||| | ||||||||  ||| || |||||||||||||||||||||||||||||| ||||||| |    
4811693 aaaaatgcaacaaaaatgataattgaaggaccgttttgttctgttttaaaaatgcatgatcagtttcatgagtaggccaaaacacgaggatcaaaagtat 4811792  T
170 aattaa 175  Q
    ||||||    
4811793 aattaa 4811798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 42 - 178
Target Start/End: Original strand, 3835135 - 3835271
Alignment:
42 tttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgag 141  Q
    ||||||| ||||||||||||||||||| |||||||| |||||||||||| || ||||||  ||||||| | |||||||  |||| ||||| |||| ||||    
3835135 tttggaggataaaatggggggtaggacgaaaaatgccacaaaaatgataattaaaggacaattttgttctgttttaaagaggcaggaccattttcgtgag 3835234  T
142 taggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    |||| ||||||||  ||||||||||||||||||||||    
3835235 taggtcaaaacacatggaccaaaagtgtaattaaacc 3835271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 36 - 175
Target Start/End: Original strand, 29035040 - 29035179
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagttt 135  Q
    ||||||||||||| | ||||||| |||| |||| |||||||||||||||||||||  | ||||||  ||||||| | |||||||||||||  |||| |||    
29035040 tgcgtttttggaggaaaaaatggagggtgggacgaaaaatgcaacaaaaatgataactaaaggacaattttgttctgttttaaaagggcataaccaattt 29035139  T
136 catgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||||||||| ||||||||||||| ||||||||||||||    
29035140 cgtgagtaggctaaaacacgaggacgaaaagtgtaattaa 29035179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 37 - 175
Target Start/End: Complemental strand, 18296285 - 18296148
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| |||||||||||| |||||| |||||||||||||||||||||  |||||||| |||||||| | |||||||||||||| | || |||     
18296285 gcgtttttggaggataaaatggggg-taggacgaaaaatgcaacaaaaatgataaatgaaggacggttttgttctgttttaaaagggcaatatcaatttt 18296187  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     |||||| | |||||||||||||| |||| | |||||||    
18296186 gtgagtaagtcaaaacacgaggactaaaattataattaa 18296148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 92 - 175
Target Start/End: Complemental strand, 1149551 - 1149468
Alignment:
92 ttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||| ||||||| | ||||||||||||| |||||||||| |||||||||||||||||||||| |||||||||||||||    
1149551 ttgaaggaccattttgttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggatcaaaagtgtaattaa 1149468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 7 - 85
Target Start/End: Original strand, 35163561 - 35163639
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaa 85  Q
    |||||||||| |||||||||||||||||||| ||||||||||   ||||| || |||||||| |||| ||||| |||||    
35163561 agggggtaggcctaaaactgtcatttctctgtgtttttggagttgaaaataggaggtaggactaaaactgcaaaaaaaa 35163639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 194
Target Start/End: Complemental strand, 835535 - 835378
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagttt 135  Q
    |||||||||||||   ||||| ||||||||||| |||  ||||| ||||||||||||| | |||| ||||||||  |||| |||  |||||||||| |||    
835535 tgcgtttttggaggtgaaaatagggggtaggactaaagctgcaa-aaaaatgatagtttagggacagttttgttcgatttgaaagaggcaagaccatttt 835437  T
136 catgagtaggccaaaacacgaggaccaaaagtgtaattaaacccaacttttattatgat 194  Q
    | ||||  |   ||||   |||||||||||||| |||||| || || |||||| |||||    
835436 cgtgagctgctaaaaatgtgaggaccaaaagtgcaattaagcctaatttttatcatgat 835378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 22534214 - 22534267
Alignment:
122 ggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| ||||| |||| ||||| || ||||| |||||||||||||||||||||||    
22534214 ggcaggaccattttcgtgagttggtcaaaatacgaggaccaaaagtgtaattaa 22534267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 36 - 100
Target Start/End: Original strand, 33096011 - 33096075
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggac 100  Q
    |||||||||||||   ||||| ||||||||||| |||| ||||| ||| ||||||||| ||||||    
33096011 tgcgtttttggaggtgaaaatagggggtaggactaaaattgcaaaaaacatgatagtttaaggac 33096075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 141; Significance: 5e-74; HSPs: 48)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 19359307 - 19359139
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
19359307 agggggtaggtctagaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 19359208  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| ||||||||||||||| |||||||||| |||||||||||||||| |||||||||||||||||||||    
19359207 gttctattttaaaagggcaggaccagtttcgtgagtaggccaaaacaagaggaccaaaagtgtaattaa 19359139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 2865129 - 2865297
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |||||||||||||||    
2865129 agggggtaggtctaaaactgtcatttctctacgtttttggagaataaaatggggggtaggacgaaaaatgaaacaaaaatgataattgaaggaccgtttt 2865228  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
2865229 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 2865297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 18183343 - 18183511
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||| |||||||||||||||    
18183343 agggggtaggtctaaaactgttatttctctgcgtttttggagaataaaatgaggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 18183442  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
18183443 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 18183511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 10 - 175
Target Start/End: Complemental strand, 8647606 - 8647441
Alignment:
10 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |||||||    
8647606 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccattttgtt 8647507  T
110 atattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     | |||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
8647506 ctgttttaaaacggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 8647441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 5819303 - 5819471
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||    
5819303 agggggtagatctaaaactgtcatttctttgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaatgaccgtttt 5819402  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
5819403 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 5819471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 24362210 - 24362378
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
24362210 aggggataagtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgatacttgaaggaccgtttt 24362309  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     || | ||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||    
24362310 attctgttttaaaagggcaggaccagtttcgtgagtaggccaaaatacgaggaccaaaagtgtaattaa 24362378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 11 - 178
Target Start/End: Original strand, 15372251 - 15372418
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtta 110  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||  |||| || ||||||||||||||||||||| ||||||||||||||||||     
15372251 ggtaggtctaaaactgtcatttctctgcgtttttggaaaataaaatgggatgtagaacaaaaaatgcaacaaaaatgatacttgaaggaccgttttgttc 15372350  T
111 tattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    | ||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||    
15372351 tgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 15372418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 15709141 - 15708974
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||||||| |||||||||||||||    
15709141 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggg-taggacgaaatatgcaacaaaaatgataattgaaggaccgtttt 15709043  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||||||||  ||||||||| ||||||||||||||||| ||||||||||||||||||||    
15709042 gttctgttttaaaagggcataaccagtttcgtgagtaggccaaaacactaggaccaaaagtgtaattaa 15708974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 8461101 - 8460933
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||| |||||||||    
8461101 agggggtaggtctaaaactgtcatttctctgcatttttggagaataaaatggggggtatgacgaaaaatgcaacaaaaatgataattgaatgaccgtttt 8461002  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| |||||||||||||| |||| ||||||||||| ||||||    
8461001 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaatacgatgaccaaaagtggaattaa 8460933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 14215617 - 14215785
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||| ||||||||||||||||||||| |||||||||||||||    
14215617 agggggtaggtctaaaactgtcatttctctacgtttttggagaataaaatgggggttaagacgaaaaatgcaacaaaaatgatacttgaaggaccgtttt 14215716  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| || ||||||| |||||||| ||||||||||||||||||| |||||||||    
14215717 gttctgttttaaaagggcaggatcagtttcgtgagtaggtcaaaacacgaggaccaaaattgtaattaa 14215785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 11 - 175
Target Start/End: Original strand, 29455120 - 29455284
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtta 110  Q
    |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| |||||||     
29455120 ggtatgtctaaaactgtcatttctctacgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccattttgttc 29455219  T
111 tattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||||||||||||| |||||||||| ||||||| ||||||||||||||||||| ||||||||||    
29455220 tgttttaaaagggcaggaccagtttcgtgagtagaccaaaacacgaggaccaaaggtgtaattaa 29455284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 164565 - 164733
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
164565 agggggtaggtctaaaactgtcatttctctacatttttggagaataaaatggggggtaggacaaaaaatgcaacaaaaatgataattgaaggaccgtttt 164664  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||||||||||||||||||  ||||| |||||||||| ||||| ||||| | |||||||    
164665 gttctgttttaaaagggcaagaccagtttagtgagttggccaaaacatgaggatcaaaattataattaa 164733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 13 - 175
Target Start/End: Original strand, 14463901 - 14464062
Alignment:
13 taggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttata 112  Q
    |||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||| |||||||||| |||||||| ||||||||| ||    
14463901 taggtctaaaactgtcatttctctgcgtttttggagaataaaattgggg-taggacgaaaaatgcaataaaaatgataattgaaggatcgttttgttcta 14463999  T
113 ttttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||| ||| |  |||||| ||||||||||||||||||||||| ||||||||||||||    
14464000 ttttaaaaggacaaaattagtttcgtgagtaggccaaaacacgaggactaaaagtgtaattaa 14464062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 191
Target Start/End: Complemental strand, 18183131 - 18182957
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaa-tggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| ||| | |||||| | || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
18183131 ctaaaactgtcatttctctgcgtttctggggtataaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 18183032  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacccaacttttattat 191  Q
    ||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||||||| |  |||||||||    
18183031 aaaagggcatgaccagtttcgtgagtaggccaaaacacgatgaccaaaagtgtaattaaacctattttttattat 18182957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 5819090 - 5818929
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||| ||| ||||||||||||||||||||| ||||| |||||||||||| | ||||    
5819090 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaagacgaaaaatgcaacaaaaatgataattgaaagaccgttttgttctgtttt 5818991  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||    
5818990 aaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 5818929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 2864915 - 2864757
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||||| ||||    
2864915 ctaaaactgtcatttctctgcgtttatggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttatgtttt 2864816  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| || || |||| ||||||||||||||||| ||||||||||||||||||||    
2864815 aaaagggcatgatcaatttcgtgagtaggccaaaacacaaggaccaaaagtgtaattaa 2864757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 172
Target Start/End: Complemental strand, 24361997 - 24361843
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    |||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||||| | |||||    
24361997 ctaaaactatcatttctctgcgtttgtggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgatacttgaaggaccattttgttctgtttta 24361898  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaat 172  Q
     ||||||| || ||||||| || ||||||||||||| | ||||||||||||||||    
24361897 caagggcatgatcagtttcgtgggtaggccaaaacatggggaccaaaagtgtaat 24361843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 8647822 - 8647980
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| |  |||| ||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
8647822 ctaaaactgtcatttctctgcgtttatggagtttgaaaatagaaggtatgacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 8647921  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||    
8647922 aaaagggcaggatcagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 8647980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 19359520 - 19359678
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||||| ||||| |||||  | ||||| || |||||||| |||||| |||||||||||||| |||||||||||||||||| | ||||    
19359520 ctaaaactgccatttctctacgtttctggagtttgaaaataggaggtaggacgaaaaatccaacaaaaatgataattgaaggaccgttttgttctgtttt 19359619  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
19359620 aaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 19359678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 172
Target Start/End: Complemental strand, 24325372 - 24325218
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    |||||||| |||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||||||||| |||||||||| ||||||| | |||||    
24325372 ctaaaactatcatttctctgcgtttgtggagaataaaatggggggtaggacgaaaaatgcgacaaaaatgatacttgaaggaccattttgttctgtttta 24325273  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaat 172  Q
     ||||||| || ||||||| || ||||||||||||| | ||||||||||||||||    
24325272 caagggcatgatcagtttcgtgggtaggccaaaacatggggaccaaaagtgtaat 24325218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 16018758 - 16018592
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||| |||   |||||||||||||||||||||| ||||||  ||||||||| |||||| ||| |||||||||||||||    
16018758 agggggtaggtctaaaactgtcatttttctatatttttggagaataaaatggggg-taggacggaaaatgcaataaaaat-ataattgaaggaccgtttt 16018661  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| ||||||||||||||| || || |||| ||| ||||||||||||||| ||||||||||||||||||    
16018660 gttctattttaaaagggcatgatcaatttcgtgaataggccaaaacacgaagaccaaaagtgtaattaa 16018592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 8461315 - 8461473
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||| |||||||||||||||||| |||||  | ||||| || |||| ||| ||||||||| ||||||||||| |||||||||||||||||| | ||||    
8461315 ctaaaattgtcatttctctgcgtttctggagtttgaaaataggaggtatgacgaaaaatgcagcaaaaatgataattgaaggaccgttttgttctgtttt 8461414  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||| || ||||||| ||||||||||||||||||||||||||||||||||||||    
8461415 aaaagagcaggaacagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 8461473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 14215402 - 14215244
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| |||||||||||||||||||||  ||||||||| ||||||| | ||||    
14215402 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataactgaaggacctttttgttctgtttt 14215303  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||| |  ||||||||| |||||| |||||||||||||||||||||||||||||||    
14215302 aaaagggtataaccagtttcgtgagtaagccaaaacacgaggaccaaaagtgtaattaa 14215244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 11 - 156
Target Start/End: Complemental strand, 25000257 - 25000112
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtta 110  Q
    ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||| || ||||||| |||| ||     
25000257 ggtagatctaaaactgtcatttctctacgtttttggagaataaaatggggggtaggacaaaaaatgcaataaaaatgataattaaaggaccattttattc 25000158  T
111 tattttaaaagggcaagaccagtttcatgagtaggccaaaacacga 156  Q
    | |||||| |||||| |||||  ||| |||||||||||||||||||    
25000157 tgttttaacagggcatgaccaaattcgtgagtaggccaaaacacga 25000112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 24331934 - 24332106
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggac-caaaaatgcaac-aaaaatgatagttgaaggaccgtt 104  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||  ||||||||||| |||||||||| ||| |||||||||    
24331934 aggggataggtctaaaactgtcatttctctgcgtttttggagaatagaatggggggtaggacgaaaaaatgcaacaaaaaatgataattgcaggaccgtt 24332033  T
105 ttgttatatttt-aaaagggcaagaccagtttcatgagtaggccaaaacacgaggacc-aaaagtgtaattaa 175  Q
    ||||| | |||| |||| |||| || ||||||| |||||| ||||||||| || |||| ||||||||||||||    
24332034 ttgttctgttttaaaaaaggcaggatcagtttcgtgagtatgccaaaacatgatgaccaaaaagtgtaattaa 24332106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 16 - 178
Target Start/End: Original strand, 16018969 - 16019132
Alignment:
16 gtctaaaactgtcatttctctgcgtttttggagaataaaa-tggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatt 114  Q
    ||||||||||||||||||||||||||| |||||  ||||| | || |||||||| |||||| |||||||||||||| |||||| ||| |||| || ||||    
16018969 gtctaaaactgtcatttctctgcgtttctggagtttaaaaataggaggtaggacgaaaaatacaacaaaaatgataattgaagaaccattttattctatt 16019068  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||||||| ||| ||||| |||| |||||| ||||||||| ||||||||||||||||||||||||    
16019069 ttaaaagagcaggaccaatttcgtgagtatgccaaaacatgaggaccaaaagtgtaattaaacc 16019132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 164350 - 164194
Alignment:
19 taaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    ||||| |||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||| ||||| ||||| |||||||||||| | || ||    
164350 taaaattgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaa-tgataattgaatgaccgttttgttttgttata 164252  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||| |||||||||| |||||||| |||||||||||||||||||||||||||||    
164251 aaagggcaggaccagtttcgtgagtaggtcaaaacacgaggaccaaaagtgtaattaa 164194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 16 - 175
Target Start/End: Original strand, 25000471 - 25000631
Alignment:
16 gtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatt 114  Q
    |||||||||||||||||||||||||||||||||  | ||||| || ||| |||| ||||||||||||||||||||| ||||| |||| ||||||| | ||    
25000471 gtctaaaactgtcatttctctgcgtttttggagtttgaaaataggaggtgggacgaaaaatgcaacaaaaatgataattgaatgaccattttgttctgtt 25000570  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||  || ||||| |||| |||||||||||||||| || ||||||||||||||||||    
25000571 ttaaaagaacatgaccaatttcgtgagtaggccaaaacatgaagaccaaaagtgtaattaa 25000631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 29454901 - 29454743
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||| |||||||||||||||| |||||  | ||||| || |||||||| ||||||||| ||||||||||| || ||||||||||||||| | ||||    
29454901 ctaaaactatcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcagcaaaaatgataattcaaggaccgttttgttctgtttt 29454802  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| ||||| |||| ||||||||||||||||| | ||||||||||| ||||||    
29454801 aaaagggcatgaccaatttcgtgagtaggccaaaacacaatgaccaaaagtgaaattaa 29454743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 24331722 - 24331562
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaat--gatagttgaaggaccgttttgttatatt 114  Q
    ||||||||||||||||||||||||| |||||  | ||||| || | |||||  ||||||||||||||||   |||| |||||||||||||||||| | ||    
24331722 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggagctaggatgaaaaatgcaacaaaaaatagataattgaaggaccgttttgttctgtt 24331623  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||| |||||||||| |||||||  |||||||||||||||||||||||||||||    
24331622 ttaaaagggcaggaccagtttcgtgagtagatcaaaacacgaggaccaaaagtgtaattaa 24331562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 36 - 175
Target Start/End: Original strand, 7349420 - 7349559
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagttt 135  Q
    ||||||||||||| | ||||||||||||||||  |||| ||||||||||||||||  |||||||  |||||||| | ||||||||| ||| ||||| |||    
7349420 tgcgtttttggaggaaaaaatggggggtaggatgaaaagtgcaacaaaaatgataactgaaggatagttttgttttgttttaaaagagcaggaccaattt 7349519  T
136 catgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||||||| ||||||||||||||||||||||||||||||    
7349520 cgtgagtagaccaaaacacgaggaccaaaagtgtaattaa 7349559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 15709353 - 15709510
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||||||||||||||| || |||||  | ||||| || |||||||| |||||||||||| ||||||||  | ||||||||||||||| | ||||    
15709353 ctaaaactgtcatttctctgcgcttatggagtttgaaaataggaggtaggacgaaaaatgcaacagaaatgataactaaaggaccgttttgttctgtttt 15709452  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| ||||| ||| |||||||||||||||||||||||| | ||||||||||||||||||    
15709453 aaa-gggcatgactagtttcatgagtaggccaaaacacaatgaccaaaagtgtaattaa 15709510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 58 - 175
Target Start/End: Original strand, 4222147 - 4222264
Alignment:
58 gggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgag 157  Q
    ||||||||||| |||||||||| ||||||||||  |||| |||  ||||||| | ||||||||||||| ||||| |||| |||| || ||||||||||||    
4222147 gggggtaggacgaaaaatgcaataaaaatgataactgaatgacaattttgttctgttttaaaagggcatgaccattttcgtgagaagcccaaaacacgag 4222246  T
158 gaccaaaagtgtaattaa 175  Q
    ||||||||||||||||||    
4222247 gaccaaaagtgtaattaa 4222264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 19 - 175
Target Start/End: Complemental strand, 15372030 - 15371874
Alignment:
19 taaaactgtcatttctctgcgtttttggagaata-aaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    ||||||| |||||||||||||||| | |||  |  |||| || ||| |||| ||||||||||||||||||||| |||||||||| ||||||| | |||||    
15372030 taaaactatcatttctctgcgtttctagagtttgcaaataggaggtgggacgaaaaatgcaacaaaaatgataattgaaggaccattttgttctgtttta 15371931  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||| |||||  ||| ||||||| |||||| ||||||| |||||||||||||||    
15371930 aaagggcaggacca-attcgtgagtagaccaaaatacgaggatcaaaagtgtaattaa 15371874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 52 - 175
Target Start/End: Complemental strand, 7348685 - 7348562
Alignment:
52 aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaa 151  Q
    ||||||||||||||||| |||| ||||||||||||||||   ||||||  |||||||| | ||||||||||||| ||||| |||| ||||||| | ||||    
7348685 aaaatggggggtaggacgaaaagtgcaacaaaaatgataaccgaaggaaagttttgttctgttttaaaagggcacgaccaatttcgtgagtagactaaaa 7348586  T
152 cacgaggaccaaaagtgtaattaa 175  Q
    || ||||||||||| |||||||||    
7348585 catgaggaccaaaaatgtaattaa 7348562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 40 - 177
Target Start/End: Original strand, 6019177 - 6019314
Alignment:
40 tttttggagaataaaatggggggtaggaccaaaa-atgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcat 138  Q
    ||||||||| |||||||||| |||||||| |||| ||||||||||||||||| || || ||| |||||||| | ||||||||| |||||| ||||||| |    
6019177 tttttggaggataaaatgggaggtaggacgaaaaaatgcaacaaaaatgataattaaaagacagttttgttctgttttaaaagagcaagatcagtttcgt 6019276  T
139 gagtaggccaaaacacgaggaccaaaagtgtaattaaac 177  Q
    ||||| ||||||||| || |||||||| |||||| ||||    
6019277 gagta-gccaaaacatgatgaccaaaaatgtaatcaaac 6019314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 38 - 175
Target Start/End: Complemental strand, 4623286 - 4623151
Alignment:
38 cgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttca 137  Q
    ||||||||||| |||||||||||  ||||||  ||||||| | |||||||||| |||||||||  ||||||| | |||||||  |||| ||||| ||||     
4623286 cgtttttggaggataaaatgggg--taggacggaaaatgccataaaaatgataattgaaggacaattttgttctgttttaaagaggcaggaccaatttcg 4623189  T
138 tgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||| | |||||||||| ||||||||||||||||||    
4623188 tgagtaagtcaaaacacgatgaccaaaagtgtaattaa 4623151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 39 - 165
Target Start/End: Original strand, 4624631 - 4624757
Alignment:
39 gtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcat 138  Q
    ||||||| || ||||||||||||||||||| |||||||||||| |||||||| ||||| ||  |||||||||| |||||||  | || ||||| |||| |    
4624631 gtttttgaaggataaaatggggggtaggacgaaaaatgcaacataaatgataattgaatgatagttttgttatgttttaaagagacatgaccaatttcgt 4624730  T
139 gagtaggccaaaacacgaggaccaaaa 165  Q
    |||||||  ||||||||||||| ||||    
4624731 gagtaggttaaaacacgaggacgaaaa 4624757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 40 - 184
Target Start/End: Complemental strand, 4219800 - 4219657
Alignment:
40 tttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatg 139  Q
    ||||||||| |||||||||||| |||||| |||||||||||||||||||||  | ||||||   |||||| | |||||||| |||| ||||| |||  |     
4219800 tttttggaggataaaatggggg-taggacgaaaaatgcaacaaaaatgataactaaaggacaactttgttctgttttaaaaaggcatgaccatttttgta 4219702  T
140 agtaggccaaaacacgaggaccaaaagtgtaattaaacccaactt 184  Q
    | ||| |||||||||||||| ||||||||||||||| || |||||    
4219701 aatagcccaaaacacgaggatcaaaagtgtaattaagccaaactt 4219657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 39 - 175
Target Start/End: Complemental strand, 6018452 - 6018317
Alignment:
39 gtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcat 138  Q
    ||||||||||   ||||| | ||||||||| |||| |||||||||||||||| |||||| |   ||||||| | |||||||||| || |||||||||| |    
6018452 gtttttggaggtgaaaatagagggtaggactaaaactgcaacaaaaatgataattgaag-ataattttgttctgttttaaaaggacatgaccagtttcgt 6018354  T
139 gagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||  ||||||||||| ||||||| |||||||||    
6018353 gagtagaacaaaacacgagaaccaaaaatgtaattaa 6018317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 36 - 96
Target Start/End: Original strand, 13814131 - 13814190
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaa 96  Q
    ||||||||||||| ||||||||||| ||||||| |||| |||||||||||||||| |||||    
13814131 tgcgtttttggaggataaaatgggg-gtaggacgaaaagtgcaacaaaaatgataattgaa 13814190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 16 - 175
Target Start/End: Original strand, 41834443 - 41834602
Alignment:
16 gtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaa-atgatagttgaaggaccgttttgttatatt 114  Q
    |||||||||||||||||||||||||||   |||   ||||| || |||||||| |||| ||||| |||| |||||||||  ||||| ||||||||  ||     
41834443 gtctaaaactgtcatttctctgcgtttcaagagttgaaaataggaggtaggactaaaactgcaaaaaaacatgatagtt-taggacggttttgttcgatc 41834541  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | |||  |||| ||||| |||| ||||  || |||||  ||||||||||||||||||||||    
41834542 tgaaagaggcaggaccattttcgtgagctggtcaaaatgcgaggaccaaaagtgtaattaa 41834602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 10721945 - 10721789
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    ||||||||||||||||||| ||||| |||||   ||||| || |||||||| |||| ||||| ||| |||||||||  |||||  |||||||  |||| |    
10721945 ctaaaactgtcatttctctacgtttctggagttgaaaataggaggtaggactaaaactgcaaaaaacatgatagtt-taggacgattttgttcgatttga 10721847  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||  | |||||||| |||| ||||  || |||||   ||||||||||| |||||||||    
10721846 aagagacaagaccattttcgtgagctggtcaaaatgtgaggaccaaaaatgtaattaa 10721789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 52 - 191
Target Start/End: Original strand, 20266335 - 20266474
Alignment:
52 aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaa 151  Q
    ||||| ||||||||||| |||| | ||||||  ||||||||| | ||||  |||||||  |||| |||  | || ||||| |||| | ||  || |||||    
20266335 aaaatagggggtaggactaaaactacaacaaccatgatagtttagggacgattttgttcgatttgaaagagacatgaccattttcgtaagctggtcaaaa 20266434  T
152 cacgaggaccaaaagtgtaattaaacccaacttttattat 191  Q
     |||||||||||||||| ||||||||| || |||||||||    
20266435 tacgaggaccaaaagtgcaattaaacctaaattttattat 20266474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 7 - 61
Target Start/End: Original strand, 24325585 - 24325639
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggg 61  Q
    ||||| || ||||||||||||||||||||||   || ||||||||||||||||||    
24325585 aggggataagtctaaaactgtcatttctctgtacttctggagaataaaatggggg 24325639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 7 - 48
Target Start/End: Complemental strand, 16752752 - 16752711
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggag 48  Q
    ||||||||||||||||||| |||||||| ||||||| |||||    
16752752 agggggtaggtctaaaactatcatttctttgcgtttatggag 16752711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 96
Target Start/End: Complemental strand, 14462730 - 14462686
Alignment:
52 aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaa 96  Q
    ||||| || |||||||| ||||||||||||||||||||| |||||    
14462730 aaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaa 14462686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 79
Target Start/End: Original strand, 28495220 - 28495288
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaa 79  Q
    ||||||||||||||| ||||||||||||| || |||||   ||||| || |||||||| |||| |||||    
28495220 ggtaggtctaaaactatcatttctctgcggttctggagttgaaaataggaggtaggactaaaactgcaa 28495288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 42)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 50970652 - 50970820
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
50970652 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 50970751  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| | ||||||||||||||||||||||||||||||||||||    
50970752 gttctgttttaaaagggcaggaccagtttcgtaagtaggccaaaacacgaggaccaaaagtgtaattaa 50970820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 178
Target Start/End: Original strand, 5962952 - 5963123
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| ||| |||||    
5962952 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaagactgtttt 5963051  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||| ||||||||||||||| || ||||||| |||||||||||||||||||||||||||||||||||||||||    
5963052 gttctattttaaaagggcatgatcagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 5963123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 15173267 - 15173096
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||    
15173267 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaagaaccgtttt 15173168  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    |||  |||||||||||||| ||| |||||| |||||||||||||||||||||||||||||||||||||||||    
15173167 gttcaattttaaaagggcaggactagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 15173096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 29869791 - 29869623
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| ||| |||||||||||||||    
29869791 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggtgtaggacgaaaaatgcaacaaaaataataattgaaggaccgtttt 29869692  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||    
29869691 gttctgttttaaaagggcaagaccagtttcgtgagtatgccaaaacacgaggaccaaaagtgtaattaa 29869623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 5540194 - 5540360
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |    
5540194 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttct 5540293  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | | |||||||||| || |||||||||| ||||||||||||||||||||||||||||||||||||||    
5540294 tctgttttaaaaggacaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 5540360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 9 - 175
Target Start/End: Complemental strand, 29307122 - 29306956
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
29307122 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgt 29307023  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | | |||||||||| || |||||||||| |||||||||||||||||||||| |||||||||||||||    
29307022 tctgttttaaaaggacatgaccagtttcgtgagtaggccaaaacacgaggatcaaaagtgtaattaa 29306956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 134; E-Value: 8e-70
Query Start/End: Original strand, 10 - 175
Target Start/End: Original strand, 33144296 - 33144461
Alignment:
10 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| || |||||||    
33144296 gggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgatatttgaaggtccattttgtt 33144395  T
110 atattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
33144396 ctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 33144461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 18984290 - 18984122
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
18984290 aggggttaggtctaaaactatcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 18984191  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||    
18984190 gttctgttttaaaagggcaggaccagtttcgtgagtagaccaaaacacgaggaccaaaagtgtaattaa 18984122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 21856417 - 21856585
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||||    
21856417 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggagtaggacgaaaaatgcagcaaaaatgatacttgaaggaccgtttt 21856516  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||    
21856517 gttctgttttaaaaaggcaggatcagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 21856585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 15646571 - 15646737
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||    
15646571 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaattgggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgt 15646670  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | | ||||||||||| | || ||||||| ||||||||||||||||||||||||||||||||||||||    
15646671 tctgttttaaaagggtaggatcagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 15646737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 129; E-Value: 8e-67
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 17433387 - 17433219
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||| |||||||||||||||    
17433387 aggggataggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggatgaaaaatgcaacaaaaatgatacttgaaggaccgtttt 17433288  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |  |||||||||||||||||||||||| |||||||||||||||||||||    
17433287 gttctgttttaaaagggcatggtcagtttcatgagtaggccaaaacatgaggaccaaaagtgtaattaa 17433219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 9019144 - 9018976
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||| ||||||| | | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||    
9019144 agggggtagatctaaaaatataatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgatagttgaatgaccgtttt 9019045  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||||||||  ||||||||| | ||||||||||||||||||||||||||||||||||||    
9019044 gttctgttttaaaagggcagaaccagtttcgttagtaggccaaaacacgaggaccaaaagtgtaattaa 9018976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 8678916 - 8679083
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||| || |||||| ||||||||||||||||||||| ||||| |||| ||||    
8678916 agggggtaggtctaaaactgtcatttctctgcatttttggagaataaaatggagg-taggacgaaaaatgcaacaaaaatgataattgaatgaccttttt 8679014  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||| | ||||||||||||||||||||||||||||||||||||||    
8679015 gttctgttttaaaagggcaggaccagttccgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 8679083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 15 - 175
Target Start/End: Complemental strand, 39154182 - 39154022
Alignment:
15 ggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatt 114  Q
    |||||||||||||||||||| ||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||| |||||||||||||| | ||    
39154182 ggtctaaaactgtcatttctatgcgtttttggagaatagaatggggggtaggacgaaaaatgcaacaaaaatgataattgcaggaccgttttgttctgtt 39154083  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||| || ||||||| |||||| ||||||||| || ||||||||||||||||||    
39154082 ttaaaagggcatgatcagtttcgtgagtatgccaaaacatgatgaccaaaagtgtaattaa 39154022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 29307317 - 29307484
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttg 107  Q
    |||||||||||||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| ||||||||||||||||    
29307317 ggggtaggtctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttg 29307416  T
108 ttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    || | ||||||||||||| |||||||||| |||||||| |||||||||||||||||||||| ||||||    
29307417 ttctgttttaaaagggcaggaccagtttcgtgagtaggtcaaaacacgaggaccaaaagtgcaattaa 29307484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 11 - 175
Target Start/End: Original strand, 26859438 - 26859601
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgtta 110  Q
    ||||||||||||||| | |||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||| |||||     
26859438 ggtaggtctaaaactattatttctctgcgtttttggagaataaa-tggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtattgttc 26859536  T
111 tattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | ||||||||||||| ||  |||||| ||||||| |||||||||||||| |||||||||||||||    
26859537 tgttttaaaagggcaggattagtttcgtgagtagcccaaaacacgaggatcaaaagtgtaattaa 26859601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 16 - 175
Target Start/End: Original strand, 17433597 - 17433757
Alignment:
16 gtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatt 114  Q
    ||||||||||||||||||||||||||| || ||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||    
17433597 gtctaaaactgtcatttctctgcgtttctgaagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtt 17433696  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||| |||||||||| ||||||||||| ||||||||||||||||||||||||||    
17433697 ttaaaagggcatgaccagtttcgtgagtaggccagaacacgaggaccaaaagtgtaattaa 17433757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 29870003 - 29870161
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |  ||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
29870003 ctaaaactgtcatttctctgcgtttctaaagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 29870102  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||    
29870103 aaaatggcaggaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 29870161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 8678702 - 8678544
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||| ||||||| || ||  | ||||| |  |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
8678702 ctaaaactgtcatttctttgcgtttctgaagtttgaaaatagcaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttttgtttt 8678603  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
8678602 aaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 8678544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 39154404 - 39154562
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||| |||||||||||||||||| || ||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||| ||||||||| ||||    
39154404 ctaaaattgtcatttctctgcgtttctgaagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccattttgttatgtttt 39154503  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
39154504 aaaagagcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 39154562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 20 - 175
Target Start/End: Complemental strand, 50970437 - 50970281
Alignment:
20 aaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaa 118  Q
    ||||||||||||||||||||||| |||||  | ||||| |  |||||||| ||||||||||||||||||||| |||||||||||||||||| |  |||||    
50970437 aaaactgtcatttctctgcgtttctggagtttgaaaatagaaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgatttaa 50970338  T
119 aagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
50970337 aagagcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 50970281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 5539977 - 5539819
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||| ||||||| |||||  | ||||| || |||||||| |||||| |||||||||||||| |||||||||||||||||| | ||||    
5539977 ctaaaactgccatttctatgcgtttatggagtttgaaaataggaggtaggacgaaaaatacaacaaaaatgataattgaaggaccgttttgttctgtttt 5539878  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||    
5539877 aaaagggcaggaccaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 5539819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 21856203 - 21856045
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || | |||||  ||||||||||||||||||||| |||||||||||||||||| | ||||    
21856203 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggagctaggatgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 21856104  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| |||||||  |||||||||||||||||||||||||||||    
21856103 aaaagggcaggaccagtttcgtgagtagatcaaaacacgaggaccaaaagtgtaattaa 21856045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 175
Target Start/End: Original strand, 4636356 - 4636513
Alignment:
19 taaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttta 117  Q
    ||||| |||||||||||||||||| |||||  | ||||| || ||| |||| ||||||||||||||||||||| |||||||| ||||||||| | |||||    
4636356 taaaattgtcatttctctgcgtttctggagtttgaaaataggaggtgggacgaaaaatgcaacaaaaatgataattgaaggatcgttttgttctgtttta 4636455  T
118 aaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||    
4636456 aaagggcaggatcagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 4636513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 170
Target Start/End: Complemental strand, 33144078 - 33143925
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| | |||  | ||||| || |||||||| ||| |||||| |||||||||| |||||||||||||||||| | ||||    
33144078 ctaaaactgtcatttctctgcgtttctagagtttgaaaataggaggtaggacgaaatatgcaaaaaaaatgataattgaaggaccgttttgttctgtttt 33143979  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgta 170  Q
    ||||||||| |||||||||| |||||||||||||||||||||||||||||||||    
33143978 aaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgta 33143925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 15173478 - 15173635
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| | |||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||| ||||||| | ||||    
15173478 ctaaaactgtcatttctctgcgtttatagagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccattttgttctgtttt 15173577  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||| |||||||||  ||||||||||||||||||||||||||||||||||||||    
15173578 aaaa-ggcaggaccagttttgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 15173635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 15646353 - 15646195
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||| ||| |||||  | |||||  | |||||||| ||||||||||||||||||||| |||||| ||| ||||||| | ||||    
15646353 ctaaaactgtcatttctctgcatttatggagtttgaaaatatgaggtaggacgaaaaatgcaacaaaaatgataattgaagtaccattttgttctgtttt 15646254  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||| |||||||||||||||||||||||||||||| |||||||    
15646253 aaaagggcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtataattaa 15646195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 18984503 - 18984661
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| |||||||||| |||| | |||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
18984503 ctaaaactgccatttctctgtgtttctagagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 18984602  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| ||||| |||| ||||||||||||||||| ||||||||||||||||||||    
18984603 aaaagggcaggaccaatttcgtgagtaggccaaaacacaaggaccaaaagtgtaattaa 18984661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 9019338 - 9019505
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttg 107  Q
    |||| |||||||||||||| |||||||||||||| ||| |  | ||||| || |||||||| ||||||||||||||||||||| ||||| ||||||||||    
9019338 ggggcaggtctaaaactgttatttctctgcgtttctggggtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaatgaccgttttg 9019437  T
108 ttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    || | |||||||| ||||  ||||||||  |||||||| |||||||||||||||||||||||||||||    
9019438 ttctgttttaaaatggcagaaccagttttgtgagtaggtcaaaacacgaggaccaaaagtgtaattaa 9019505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 7 - 105
Target Start/End: Complemental strand, 4636143 - 4636045
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttt 105  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||||| ||||||||||||||    
4636143 agggggtaggtctaaaactgtcatttctctgcgtttttgaagaataaaatggggggtagaacaaaaaatgcaacaaaaatgatacttgaaggaccgttt 4636045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 61 - 175
Target Start/End: Complemental strand, 26859176 - 26859062
Alignment:
61 ggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggac 160  Q
    |||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||||| |||| |||||||||| | ||||||||||||||| |||||    
26859176 ggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgttttaaaatggcaggaccagtttcgttagtaggccaaaacacaaggac 26859077  T
161 caaaagtgtaattaa 175  Q
    |||||||||||||||    
26859076 caaaagtgtaattaa 26859062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 38 - 175
Target Start/End: Complemental strand, 52268430 - 52268293
Alignment:
38 cgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttca 137  Q
    ||||||||||| | ||||||||||||||||| |||| ||||||||||||||||  |||| ||| |||||||| | ||||||||||||| ||||| ||||     
52268430 cgtttttggaggaaaaaatggggggtaggacgaaaagtgcaacaaaaatgataactgaatgacagttttgttctgttttaaaagggcaggaccaatttcg 52268331  T
138 tgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| ||||||||| |||||||||||||||||||||||    
52268330 tgagcaggccaaaatacgaggaccaaaagtgtaattaa 52268293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 5962739 - 5962581
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||||||| ||||| |||| |||||  | ||||| || ||||| || ||||||||||||||||||||||||||| |||||||||||| | ||||    
5962739 ctaaaactgtcattactctgtgtttctggagtttgaaaataggaggtagaacgaaaaatgcaacaaaaatgatagttgaaagaccgttttgttctgtttt 5962640  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||  |||||||||| ||| ||| ||| |||||||||||||||| |||||||||    
5962639 aaaagggccggaccagtttcgtgaatagaccataacacgaggaccaaaaatgtaattaa 5962581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 17112442 - 17112285
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||| |||||| ||||||||| |||||  | ||||| || |||||||| |||||||||| |||||||||| |||||||||  |||| || ||||||    
17112442 ctaaaactatcatttttctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaataaaaatgataattgaaggactattttattctatttt 17112343  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||   |||| ||||||||||||  ||||||| ||| |||||||||||||||||    
17112342 aaaagggc-ctaccaatttcatgagtagatcaaaacatgagaaccaaaagtgtaattaa 17112285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 103 - 175
Target Start/End: Complemental strand, 47827039 - 47826967
Alignment:
103 ttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||||||||||||||| ||||| |||| ||||||| ||||||||||||||||||||||||||||||    
47827039 ttttgttatattttaaaagggcatgaccattttcgtgagtagaccaaaacacgaggaccaaaagtgtaattaa 47826967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 62 - 175
Target Start/End: Original strand, 52269177 - 52269290
Alignment:
62 gtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggacc 161  Q
    ||||||| |||| ||||||||||||||||  |||| |||  ||||||| | |||||||||||||  |||  ||||||||||| | |||||||||||||||    
52269177 gtaggacgaaaagtgcaacaaaaatgataactgaatgacatttttgttctgttttaaaagggcagaaccgatttcatgagtaagtcaaaacacgaggacc 52269276  T
162 aaaagtgtaattaa 175  Q
    ||||||||||||||    
52269277 aaaagtgtaattaa 52269290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 92 - 175
Target Start/End: Original strand, 2733416 - 2733499
Alignment:
92 ttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||||||||||| | ||||||||||||| ||||| ||||  || ||||||||||||| |||||||||||| |||||||    
2733416 ttgaaggaccgttttgttctgttttaaaagggcaggaccaatttcgcgaataggccaaaacacaaggaccaaaagtataattaa 2733499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 78 - 170
Target Start/End: Original strand, 47827033 - 47827125
Alignment:
78 aacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgta 170  Q
    ||||||||||||| || ||||||  ||||||| | ||||||||||||| ||||| |||| |||||||||||||||| |  || ||||||||||    
47827033 aacaaaaatgataattaaaggacaattttgttctgttttaaaagggcatgaccattttcgtgagtaggccaaaacaaggagatcaaaagtgta 47827125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 175
Target Start/End: Original strand, 17088516 - 17088682
Alignment:
8 gggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttg 107  Q
    ||||||||||||||||||||||||||||||||||| | ||    ||||| || ||||| || |||| ||||| ||| || |||||| | |||| ||||||    
17088516 gggggtaggtctaaaactgtcatttctctgcgtttctagatttgaaaataggaggtagaactaaaactgcaaaaaatat-atagtttagggacggttttg 17088614  T
108 ttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||  |||| |||  |||| ||||| |||| ||||  |  |||||   |||||||||||||||||||||    
17088615 tttgatttgaaagaggcatgaccattttcgtgagctgttcaaaatgagaggaccaaaagtgtaattaa 17088682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 51 - 136
Target Start/End: Complemental strand, 39843280 - 39843195
Alignment:
51 taaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||  |||||||||| ||||| ||| ||||||||  | |||||||||||||  |||| |||| |||| ||||||||||    
39843280 taaaatgggggtaaggaccaaaagtgcaaaaaacatgatagtatagggaccgttttgttcgatttgaaaaaggcaggaccagtttc 39843195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 38 - 175
Target Start/End: Original strand, 52235074 - 52235211
Alignment:
38 cgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttca 137  Q
    |||||||||||  ||||||| ||| ||||||||||| ||||| ||| ||||||||  | |||| | || |||  |||| ||||||||| || |||||||     
52235074 cgtttttggagggtaaaatgagggttaggaccaaaattgcaagaaacatgatagtatagggactgcttcgttcgatttgaaaagggcaggatcagtttcg 52235173  T
138 tgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||  ||||   ||||| |||||||||||||||    
52235174 tgagttggttaaaatctgaggatcaaaagtgtaattaa 52235211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 67 - 175
Target Start/End: Original strand, 50419695 - 50419803
Alignment:
67 accaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaag 166  Q
    ||||||| ||||| ||| ||||||||  | |||||||||||||  ||||||||| |||| ||||| |||| ||||| || | |||  ||| |||||||||    
50419695 accaaaagtgcaaaaaacatgatagtacagggaccgttttgttcaattttaaaaaggcaggaccaatttcgtgagttggtctaaatgcgatgaccaaaag 50419794  T
167 tgtaattaa 175  Q
    || ||||||    
50419795 tgcaattaa 50419803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 59)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 5137151 - 5136980
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
5137151 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 5137052  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||| | ||||||||||||| ||||| |||| ||||| |||||||||||||||||||||||||||||||||||    
5137051 gttctgttttaaaagggcatgaccaatttcgtgagttggccaaaacacgaggaccaaaagtgtaattaaacc 5136980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 7 - 178
Target Start/End: Complemental strand, 41046871 - 41046700
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
41046871 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 41046772  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||| | ||||||||||||| |||||||||| | | |||||||||||||||||||||||||||||||||||||    
41046771 gttctgttttaaaagggcatgaccagtttcgtaattaggccaaaacacgaggaccaaaagtgtaattaaacc 41046700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 20840731 - 20840563
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
20840731 agggggtaggtctaaaactgtcatttctctgcgtttaaggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 20840632  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| |||||||||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
20840631 gttctattttaaaaaggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 20840563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 39555951 - 39556119
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||| ||||    
39555951 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacgaaaatgataattgaaggaccatttt 39556050  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
39556051 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 39556119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 24300930 - 24301098
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||    
24300930 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgatactcgaaggaccgtttt 24301029  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| |||| ||||| |||| ||||||||||||||||||||||||||||||||||||||    
24301030 gttttgttttaaaatggcaggaccaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 24301098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 31779026 - 31779194
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||    
31779026 agggggtacgtctaaaactgacatttctctgcgtttttggagaataaaatggggggtgggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 31779125  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
31779126 gttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 31779194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 37727100 - 37726932
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||    
37727100 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttt 37727001  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| |||||||||||||  ||||||||| | || || ||||||||||||||||||||||||||||||    
37727000 gttatgttttaaaagggcagaaccagtttcgtaagcagaccaaaacacgaggaccaaaagtgtaattaa 37726932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 17464865 - 17465034
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaa-atgcaacaaaaatgatagttgaaggaccgttt 105  Q
    ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||||||||||| ||||||||||||||    
17464865 aggggttaggtctaaaactgtcatttctctgcatttttggagaataaaatggggggtaggacaaaaaaatgcaacaaaaatgataattgaaggaccgttt 17464964  T
106 tgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||||||||||||  |||||||||||||| ||||||||||||||||||||||||| |||||||||    
17464965 tgttctattttaaaagggtcagaccagtttcatgcgtaggccaaaacacgaggaccaaaaatgtaattaa 17465034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 23644633 - 23644465
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||    
23644633 agggggtaggtctaaaactattatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggactgtttt 23644534  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| |||| ||||| |||| |||||||||||||| |||||||||||||||||||||||    
23644533 gttctgttttaaaatggcaggaccaatttcgtgagtaggccaaaatacgaggaccaaaagtgtaattaa 23644465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 25853601 - 25853769
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||| ||||    
25853601 agggggtaggtctaaaactgttatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccatttt 25853700  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| | |||||||| | ||||||||||||| |||||||  ||||||||||||| |||||||||||||||    
25853701 gttctgttttaaaatgacaagaccagtttcgtgagtagagcaaaacacgaggatcaaaagtgtaattaa 25853769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 26837730 - 26837897
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |||||||||    
26837730 agggggtaagtctaaaactgtcatttctctgcatttttggagaataaaatggggggtaggacaaaaaatgcaacaaaaatgatacttgaatgaccgtttt 26837829  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| |||||| ||||||||  ||||||||| | ||||||||||||||||||||||||||||||||||||    
26837830 gttctatttt-aaagggcagaaccagtttcgtaagtaggccaaaacacgaggaccaaaagtgtaattaa 26837897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 9 - 175
Target Start/End: Complemental strand, 43973610 - 43973444
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    ||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||    
43973610 ggggtaggtctaaaactgttatttatctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgt 43973511  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | | |||||||||||||  | || |||| |||||||| |||||||||||||||||||||||||||||    
43973510 tctgttttaaaagggcataatcattttcgtgagtaggacaaaacacgaggaccaaaagtgtaattaa 43973444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 23 - 172
Target Start/End: Complemental strand, 48453144 - 48452995
Alignment:
23 actgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagg 122  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||| | |||||||| |    
48453144 actgtcatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgttttaaaatg 48453045  T
123 gcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaat 172  Q
    ||| |||||||||| ||||||||||||||||||| |||||||||||||||    
48453044 gcaggaccagtttcgtgagtaggccaaaacacgatgaccaaaagtgtaat 48452995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 7 - 175
Target Start/End: Original strand, 32535333 - 32535505
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaat-----gatagttgaaggacc 101  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||     |||| ||||||||||    
32535333 aggggttaggtctaaaactatcatttctctgcgtttttggagaataaaatggggg-taggacgaaaaatgcaacaaaaatttaatgataattgaaggacc 32535431  T
102 gttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||| | ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
32535432 gttttgttctgttttaaaagggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 32535505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 30104652 - 30104485
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||||| || ||||||||||||| |||||| ||||||||||||||||||||| ||||||||||||| |    
30104652 agggggtaggtctaaaactgtcatttctctgcgtttttagataataaaatggggg-taggacgaaaaatgcaacaaaaatgataattgaaggaccgttct 30104554  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     || | ||||||||||||| ||||| |||| |||||||| |||||||||||||||||||||||||||||    
30104553 attttgttttaaaagggcaggaccaatttcgtgagtaggtcaaaacacgaggaccaaaagtgtaattaa 30104485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 7 - 174
Target Start/End: Original strand, 22425187 - 22425354
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||| ||||||| | | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| ||||||||    
22425187 agggggtagatctaaaaatctaatttctctgcgtttttggagaataaaatggggggtaggacgaaaaatgcaacaaaaatgataattgaagtaccgtttt 22425286  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaatta 174  Q
    ||| | ||||| ||||||| |||||| ||| |||||||||| ||||||||||||||||||||||||||    
22425287 gttctgttttacaagggcatgaccagattcgtgagtaggccgaaacacgaggaccaaaagtgtaatta 22425354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 9 - 175
Target Start/End: Original strand, 27393953 - 27394119
Alignment:
9 ggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgt 108  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||   |||||||||||||||||||| |||||||| ||||||||    
27393953 ggggtaggtctaaaactgttatttctctgcgtttttggagaataaaattgggggtaggatggaaaatgcaacaaaaatgataattgaaggatcgttttgt 27394052  T
109 tatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | | |||||||| |||| ||||  |||| ||||||||||||||||||||||||||||||||||||||    
27394053 tctgttttaaaaaggcaggacctatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 27394119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 7 - 178
Target Start/End: Original strand, 26274941 - 26275111
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||| |||| ||||||||||    
26274941 agggggtaggtctaaaactgtcatttctctgcggttttggagaataaaatggggggtaggacgaaaaa-gcaacaaaaatgataattgagggaccgtttt 26275039  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
     || | ||||||||||| | |||||||||| |||||||| |||||||| ||| |||||| | ||||||||||    
26275040 attctgttttaaaagggtaggaccagtttcgtgagtaggtcaaaacacaagggccaaaattataattaaacc 26275111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 5137365 - 5137523
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || | |||||| ||||||||||||||||||||| |||||||||| ||||||| ||||||    
5137365 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggagataggactaaaaatgcaacaaaaatgataattgaaggaccattttgttctatttt 5137464  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||    
5137465 aaaagggcagaaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 5137523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 37 - 181
Target Start/End: Original strand, 25612381 - 25612525
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| ||||||||||||||||||| ||||||||||||||||||||| || || ||| |||||||| ||||||||||||||| ||||| ||||    
25612381 gcgtttttggaggataaaatggggggtaggacgaaaaatgcaacaaaaatgataattaaaagacagttttgttctattttaaaagggcaggaccaatttc 25612480  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaaacccaa 181  Q
     |||||||| |||||||||||||||||||||||||||||||||||    
25612481 gtgagtaggtcaaaacacgaggaccaaaagtgtaattaaacccaa 25612525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 25853395 - 25853237
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||| |||||||||||||| |||||  | ||||| || ||||| || ||||||||||||||||||||| |||||||||||||||||| ||||||    
25853395 ctaaaactgttatttctctgcgtttctggagtttgaaaataggaggtagaacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctatttt 25853296  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||    
25853295 aaaagggcatgaccaatttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 25853237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 31778814 - 31778656
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| |||||||||||||||||||||   |||||||||||||||| | ||||    
31778814 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataaacgaaggaccgttttgttctgtttt 31778715  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||    
31778714 aaaagggcaggaccagtttcatgagtagaccaaaacacgaggaccaaaagtgtaattaa 31778656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 37727314 - 37727472
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
37727314 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 37727413  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||| |||||||||| |||||||||||||||| |||||||||||||||||||||    
37727414 aaaagagcaggaccagtttcgtgagtaggccaaaacatgaggaccaaaagtgtaattaa 37727472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 43973824 - 43973982
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| ||| | || ||||| || |||||||| ||||||||||||||||||||| ||||| |||||||||||| | ||||    
43973824 ctaaaactgtcatttctctgcgtttctggggtatgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaatgaccgttttgttctgtttt 43973923  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||  ||||||||| ||||||||||||||||||||||||||||||||||||||    
43973924 aaaagggcagaaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 43973982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 4275748 - 4275906
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| || ||||||||||||||| | ||||    
4275748 ctaaaactgccatttctctgcgtttatggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattaaaggaccgttttgttctgtttt 4275847  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
4275848 aaaagagcatgaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 4275906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 20840945 - 20841103
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
20840945 ctaaaactgccatttctctgcgtttatggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 20841044  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||| |||||||||| |||||||||||||||||||| |||||||||||||||||    
20841045 aaaaaggcaggaccagtttcgtgagtaggccaaaacacgagcaccaaaagtgtaattaa 20841103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 27393822 - 27393664
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| ||| |  | ||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
27393822 ctaaaactgtcatttctctgcgtttctggggtttgaaaatagggggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 27393723  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||| |||||||||  |||||||| |||||||||||||||||||||||||||||    
27393722 aaaatggcaggaccagttttgtgagtaggtcaaaacacgaggaccaaaagtgtaattaa 27393664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 39555739 - 39555581
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || ||||| || ||||||||||||||||||||| |||||||||| ||||||| | ||||    
39555739 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtagaacgaaaaatgcaacaaaaatgataattgaaggaccattttgttctgtttt 39555640  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||| |||||||||| ||||||||||||||||||||||||||||||||||||||    
39555639 aaaatggcaggaccagtttcgtgagtaggccaaaacacgaggaccaaaagtgtaattaa 39555581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 17464652 - 17464494
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||| | ||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
17464652 ctaaaactgtcatttctttacgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 17464553  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| ||||||||||  || ||||||||||||||||||||||||||||||||||    
17464552 aaaagggcatgaccagtttcgcgaataggccaaaacacgaggaccaaaagtgtaattaa 17464494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 30098147 - 30098305
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||| ||||||||||| || ||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||| ||||||| | ||||    
30098147 ctaaaactgtcatatctctgcgtttctgaagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccattttgttctgtttt 30098246  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||||||||||||||||| |||||| | |||||||||||||||||||||||||||||    
30098247 aaaagggcaagaccagtttcgtgagtatgtcaaaacacgaggaccaaaagtgtaattaa 30098305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 26837521 - 26837360
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||| ||||| || |    
26837521 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgtttcgttatgttat 26837422  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||||||||| ||||| |||| |||||||||||||| || |||||||||| ||||||||||||    
26837421 aaaagggcaggaccaatttcgtgagtaggccaaaatacaaggaccaaaaatgtaattaaacc 26837360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 16 - 175
Target Start/End: Original strand, 29801798 - 29801958
Alignment:
16 gtctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatt 114  Q
    |||||||| |||||||||||||||||| |||||  | ||||| || ||| |||| ||||||||||||||||||||| ||||| |||||||||||| | ||    
29801798 gtctaaaattgtcatttctctgcgtttctggagtttgaaaataggaggtgggacgaaaaatgcaacaaaaatgataattgaaagaccgttttgttctgtt 29801897  T
115 ttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||| |||||||||| |||||||||||||| ||||||| |||||||||||||||    
29801898 ttaaaagggcaggaccagtttcgtgagtaggccaaaatacgaggatcaaaagtgtaattaa 29801958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 32535120 - 32534959
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||||||||||||| | || | |||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
32535120 ctaaaactgtcatttctctgtgattctagagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 32535021  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    |||| |||| ||||| |||| |||||| ||||||||||||||||||||||||||||||||||    
32535020 aaaaaggcaggaccaatttcgtgagtatgccaaaacacgaggaccaaaagtgtaattaaacc 32534959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 22424975 - 22424817
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||| ||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
22424975 ctaaaactgtcatttctctgcatttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 22424876  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||||| ||  ||||||||| | |||||||  ||||||||| |||||||||||||||||    
22424875 aaaaggacagaaccagtttcgtaagtaggcttaaacacgagaaccaaaagtgtaattaa 22424817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 23644849 - 23645007
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||  | |||  | ||||| || |||||||  ||||||||||||||||||||| ||||| |||||||||||| | ||||    
23644849 ctaaaactgtcatttctctgcgttactagagtttgaaaataggaggtaggatgaaaaatgcaacaaaaatgataattgaatgaccgttttgttctgtttt 23644948  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||| | ||||| |||| |||||||||||||||||||||||||||||| |||||||    
23644949 aaaagggtaggaccaatttcgtgagtaggccaaaacacgaggaccaaaagtataattaa 23645007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 57 - 175
Target Start/End: Complemental strand, 29801477 - 29801359
Alignment:
57 ggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacga 156  Q
    |||||||| ||| ||||||||||||||||||||| |||||||||||||||||| | ||||||||||||| |||||||||  |||||| ||||||||||||    
29801477 ggggggtaagacgaaaaatgcaacaaaaatgatacttgaaggaccgttttgttctgttttaaaagggcaggaccagttttgtgagtatgccaaaacacga 29801378  T
157 ggaccaaaagtgtaattaa 175  Q
     ||||||||||||||||||    
29801377 tgaccaaaagtgtaattaa 29801359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 26274728 - 26274567
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    |||||||||||||||  |||||||| |||||  | ||||| || |||| ||| ||||||||||||||||||||| |||||||||||||||||| | ||||    
26274728 ctaaaactgtcatttaactgcgtttctggagtttgaaaataggaggtatgacgaaaaatgcaacaaaaatgataattgaaggaccgttttgttctgtttt 26274629  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    ||||||||| |||||||||| ||||||| |||||| || |||| ||||| ||||||||||||    
26274628 aaaagggcaggaccagtttcgtgagtagtccaaaatacaaggatcaaaaatgtaattaaacc 26274567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 36 - 175
Target Start/End: Original strand, 50116812 - 50116951
Alignment:
36 tgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagttt 135  Q
    ||||||||||||| | ||||||||||||||||| |||| ||||||||||||||||  |||| |||||||||||| | ||| ||||||||| ||||| |||    
50116812 tgcgtttttggaggaaaaaatggggggtaggacgaaaattgcaacaaaaatgataactgaatgaccgttttgttctctttcaaaagggcatgaccaattt 50116911  T
136 catgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | |||||| | ||||||||||||| |||||||||||||||    
50116912 cgtgagtaagtcaaaacacgaggatcaaaagtgtaattaa 50116951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 39 - 175
Target Start/End: Original strand, 23228414 - 23228549
Alignment:
39 gtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcat 138  Q
    |||||||||| |||||||||| |||||||| |||||||||| |||||||||| |||||||||  |||||||   ||||||||||||| || || |||| |    
23228414 gtttttggaggataaaatgggaggtaggacgaaaaatgcaataaaaatgataattgaaggacaattttgttcg-ttttaaaagggcatgatcattttcgt 23228512  T
139 gagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||||||||||| |||||||||||||||||||    
23228513 gagtaggccaaaacacggggaccaaaagtgtaattaa 23228549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 37 - 175
Target Start/End: Original strand, 51474737 - 51474876
Alignment:
37 gcgtttttggagaataaaa-tggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagttt 135  Q
    |||||||||||| |||||| | ||||||||||| |||||||||||||||||||||  | ||||||  ||||||||| ||||||||||||| ||||| |||    
51474737 gcgtttttggaggataaaaattgggggtaggacgaaaaatgcaacaaaaatgataactaaaggacaattttgttatgttttaaaagggcatgaccaattt 51474836  T
136 catgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    | |||||| ||||||||||| | |||||||||||||||||    
51474837 cgtgagtatgccaaaacacgggaaccaaaagtgtaattaa 51474876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 24300717 - 24300557
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||||||||||||||||||| |||||  | ||||| || ||| |||| |||| |||||||||||||||| |||||| |||||||| || | ||||    
24300717 ctaaaactgtcatttctctgcgtttctggagtttgaaaataggaggtgggacgaaaattgcaacaaaaatgataattgaagaaccgttttattctgtttt 24300618  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    |||||| || |||||||||| ||| || |||||||||||| |||||||| ||||||||||||    
24300617 aaaaggacaggaccagtttcgtgaataagccaaaacacga-gaccaaaaatgtaattaaacc 24300557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 38 - 175
Target Start/End: Original strand, 32697106 - 32697242
Alignment:
38 cgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttca 137  Q
    ||||||||||| ||||||||||| ||||||| ||||||||||||||||||||| |||||| ||  ||||||| | ||||||||||||  ||| | ||||     
32697106 cgtttttggaggataaaatgggg-gtaggacgaaaaatgcaacaaaaatgataattgaagcacaattttgttctgttttaaaagggcgtgactaatttcg 32697204  T
138 tgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||| |||||||||||||||||| | |||||||    
32697205 tgagtaggctaaaacacgaggaccaaaaatataattaa 32697242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 18 - 178
Target Start/End: Original strand, 41047083 - 41047242
Alignment:
18 ctaaaactgtcatttctctgcgtttttggagaat-aaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatatttt 116  Q
    ||||||||| ||||||||||||||| |||||  | ||||| || |||||||| ||||||||||||||||||||| |||||||| |||||| || | ||||    
41047083 ctaaaactgccatttctctgcgtttctggagtttgaaaataggaggtaggacgaaaaatgcaacaaaaatgataattgaagga-cgttttattctgtttt 41047181  T
117 aaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaaacc 178  Q
    |||||| ||  ||||||||| |||||||||||||||| || || | ||||||||||||||||    
41047182 aaaaggacagaaccagtttcgtgagtaggccaaaacatgaaga-cgaaagtgtaattaaacc 41047242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 34 - 175
Target Start/End: Original strand, 25420542 - 25420683
Alignment:
34 tctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagt 133  Q
    ||||| |||||| || ||||||||||||||| ||| ||||||||||||||||| ||| |||||||||  |||| || ||||||||||||||  || || |    
25420542 tctgcatttttgaaggataaaatggggggtatgacgaaaaatgcaacaaaaataataattgaaggacaattttattctattttaaaagggcgtgatcaat 25420641  T
134 ttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| |||||||| ||||| |||| || |||||||||||||||    
25420642 ttcgtgagtaggtcaaaatacgatgatcaaaagtgtaattaa 25420683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 40 - 175
Target Start/End: Complemental strand, 45966076 - 45965941
Alignment:
40 tttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatg 139  Q
    ||||||||| | |||||||||| ||| || |||||||||||| |||||||| | |||||||  ||||||||| ||||||||| ||| ||  |  ||| ||    
45966076 tttttggaggagaaaatgggggttagaacgaaaaatgcaacacaaatgataatcgaaggacatttttgttatgttttaaaagagcaggattaacttcgtg 45965977  T
140 agtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||| |||||||||||||||||||||||||||||||    
45965976 agtatgccaaaacacgaggaccaaaagtgtaattaa 45965941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 64 - 175
Target Start/End: Complemental strand, 51473542 - 51473431
Alignment:
64 aggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaa 163  Q
    |||||||||| ||||||||||||||||   |||||||  ||||||| | ||||||||||||| ||||| |||| ||| ||| ||||||||||||||||||    
51473542 aggaccaaaagtgcaacaaaaatgataaccgaaggacaattttgttctgttttaaaagggcaggaccaatttcgtgaatagaccaaaacacgaggaccaa 51473443  T
164 aagtgtaattaa 175  Q
    ||||||||||||    
51473442 aagtgtaattaa 51473431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 37 - 175
Target Start/End: Complemental strand, 37220698 - 37220560
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgttttgttatattttaaaagggcaagaccagtttc 136  Q
    |||||||||||| ||||||||| ||||||||| |||| ||||||||||||||||  ||||||||  |||| || | ||||||||| ||| || |  | |     
37220698 gcgtttttggaggataaaatggagggtaggacgaaaagtgcaacaaaaatgataactgaaggacaattttattctgttttaaaagagcatgatcgatatt 37220599  T
137 atgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
     |||||||||||||| |||||||||||||||||||||||    
37220598 gtgagtaggccaaaatacgaggaccaaaagtgtaattaa 37220560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 49407966 - 49407799
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    ||||||||||||||||| ||||||||||||||||||||||||   ||||| || |||| ||| |||| ||  ||||||   | |||| | |||| |||||    
49407966 agggggtaggtctaaaattgtcatttctctgcgtttttggagttgaaaataggaggtatgactaaaactg-tacaaaacataaagtttagggacggtttt 49407868  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||| ||||| |||  |||| ||||| |||| ||||  || |||||  ||||||||||||||||||||||    
49407867 gttctatttgaaagaggcatgaccattttcgtgagctggtcaaaatgcgaggaccaaaagtgtaattaa 49407799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 7 - 175
Target Start/End: Complemental strand, 55192288 - 55192121
Alignment:
7 agggggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaatgatagttgaaggaccgtttt 106  Q
    |||||||||||||||||||||||||||||||||||| |||||   ||||| || |||||||| |||| | ||| ||| || |||||| | |||| |||||    
55192288 agggggtaggtctaaaactgtcatttctctgcgtttctggagttgaaaataggaggtaggactaaaactacaaaaaacat-atagtttatggacggtttt 55192190  T
107 gttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    |||  |||| |||  ||| |||||| |||| ||||  || |||||  || |||| ||||||||||||||    
55192189 gtttgatttgaaagaggcgagaccattttcgtgagctggtcaaaatgcggggactaaaagtgtaattaa 55192121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 92 - 175
Target Start/End: Original strand, 37222030 - 37222113
Alignment:
92 ttgaaggaccgttttgttatattttaaaagggcaagaccagtttcatgagtaggccaaaacacgaggaccaaaagtgtaattaa 175  Q
    ||||||||  |||||||| | |||||||| |||| ||||| |||  |||||||| |||||||||||||||||||||||||||||    
37222030 ttgaaggatggttttgttctgttttaaaatggcaggaccaattttgtgagtagggcaaaacacgaggaccaaaagtgtaattaa 37222113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 11 - 62
Target Start/End: Complemental strand, 29801583 - 29801532
Alignment:
11 ggtaggtctaaaactgtcatttctctgcgtttttggagaataaaatgggggg 62  Q
    |||| ||||||||||||||||||||||| |||||| ||||||||||||||||    
29801583 ggtatgtctaaaactgtcatttctctgcatttttgaagaataaaatgggggg 29801532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 37 - 172
Target Start/End: Complemental strand, 25419285 - 25419150
Alignment:
37 gcgtttttggagaataaaatggggggtaggaccaaaaatgcaacaaaaa-tgatagttgaa-ggaccgttttgttatattttaaaagggcaagaccagtt 134  Q
    ||||||||||||  |||||||||||  ||||| |||| ||||| ||||| ||||| ||||| |||| |||||||| | |||||||||||||  || | ||    
25419285 gcgtttttggag--taaaatgggggtaaggactaaaactgcaaaaaaaaatgataattgaaaggacagttttgttctgttttaaaagggcagaactaatt 25419188  T
135 tcatgagtaggccaaaacacgaggaccaaaagtgtaat 172  Q
    || |||||| || ||||||||| |||||||||| ||||