View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-8 (Length: 613)

Name: F9134J-LTR4-TNT-insertion-8
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9134J-LTR4-TNT-insertion-8
F9134J-LTR4-TNT-insertion-8
[»] chr7 (2 HSPs)
chr7 (23-604)||(25791946-25792527)
chr7 (371-418)||(21238713-21238760)
[»] chr1 (1 HSPs)
chr1 (451-504)||(15365611-15365664)


Alignment Details
Target: chr7 (Bit Score: 574; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 574; E-Value: 0
Query Start/End: Original strand, 23 - 604
Target Start/End: Original strand, 25791946 - 25792527
Alignment:
23 attgaagatagaaattattaaaagcggttaacatatgttactgcacaaggcttgtaaccttatgcatgtcacactagcaaaattacattactctaagttc 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25791946 attgaagatagaaattattaaaagcggttaacatatgttactgcacaaggcttgtaaccttatgcatgtcacactagcaaaattacattactctaagttc 25792045  T
123 tgcaatctcagtacgtaggaaaaactatgttacaagttacaacagaaaacaaccaagcacttgataaaagatcaaacgtagatagatactagagaaggct 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
25792046 tgcaatctcagtacgtaggaaaaactatgttacaagttacaacagaaaacaaccaagcacttgataaaagatcaaacgtagacagatactagagaaggct 25792145  T
223 attcatgattaaacagcatgttcctcatgtagaagtccttgatcaaagtgccaaacacctgcaagccacaatatataacaatatataaatttcattagaa 322  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25792146 attcatgattaaacagcatgttcctcatgtagaagtctttgatcaaagtgccaaacacctgcaagccacaatatataacaatatataaatttcattagaa 25792245  T
323 cttaaagagtgtccaccacatacgaacaccggatacaacacatacatttagacactgatagtaatttaagaaaatataagtgaatcagtgattgaaagta 422  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25792246 cttaaagagtgtccaccacatacgaacaccggatacaacacatacatttagacactgatagtaatttaagaaaatataagtgaatcagtgattgaaagta 25792345  T
423 accacgcacacgtgtcaatatcagacattgacatgtgtcggacaccagacacattttaatgtgaagtgtcggtgctacatactaattgataggtgttatg 522  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25792346 accacgcacacgtgtcaatatcagacattgacatgtgtcggacaccagacacattttaatgtgaagtgtcggtgctacatactaattgataggtgttatg 25792445  T
523 tgtatggcaaaatatgtggaccaatatgaaatatgattgtagttatatacataccatgaccctttccaacccttctcaattg 604  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25792446 tgtatggcaaaatatgtggaccaatatgaaatatgattgtagttatatacataccatgaccctttccaacccttctcaattg 25792527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 418
Target Start/End: Original strand, 21238713 - 21238760
Alignment:
371 tagacactgatagtaatttaagaaaatataagtgaatcagtgattgaa 418  Q
    |||||||||||| ||||||||||||||| |||||| | ||||||||||    
21238713 tagacactgataataatttaagaaaataaaagtgagtgagtgattgaa 21238760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 451 - 504
Target Start/End: Original strand, 15365611 - 15365664
Alignment:
451 tgacatgtgtcggacaccagacacattttaatgtgaagtgtcggtgctacatac 504  Q
    ||||| ||||||||||||||||||| ||||||||  ||||||  ||||||||||    
15365611 tgacacgtgtcggacaccagacacactttaatgtatagtgtcactgctacatac 15365664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 151845 times since January 2019
Visitors: 1573