View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9134J-LTR4-TNT-insertion-8 (Length: 613)

Name: F9134J-LTR4-TNT-insertion-8
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9134J-LTR4-TNT-insertion-8
[»] chr7 (2 HSPs)
chr7 (23-604)||(25791946-25792527)
chr7 (371-418)||(21238713-21238760)
[»] chr1 (1 HSPs)
chr1 (451-504)||(15365611-15365664)

Alignment Details
Target: chr7 (Bit Score: 574; Significance: 0; HSPs: 2)
Name: chr7

Target: chr7; HSP #1
Raw Score: 574; E-Value: 0
Query Start/End: Original strand, 23 - 604
Target Start/End: Original strand, 25791946 - 25792527
23 attgaagatagaaattattaaaagcggttaacatatgttactgcacaaggcttgtaaccttatgcatgtcacactagcaaaattacattactctaagttc 122  Q
25791946 attgaagatagaaattattaaaagcggttaacatatgttactgcacaaggcttgtaaccttatgcatgtcacactagcaaaattacattactctaagttc 25792045  T
123 tgcaatctcagtacgtaggaaaaactatgttacaagttacaacagaaaacaaccaagcacttgataaaagatcaaacgtagatagatactagagaaggct 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
25792046 tgcaatctcagtacgtaggaaaaactatgttacaagttacaacagaaaacaaccaagcacttgataaaagatcaaacgtagacagatactagagaaggct 25792145  T
223 attcatgattaaacagcatgttcctcatgtagaagtccttgatcaaagtgccaaacacctgcaagccacaatatataacaatatataaatttcattagaa 322  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25792146 attcatgattaaacagcatgttcctcatgtagaagtctttgatcaaagtgccaaacacctgcaagccacaatatataacaatatataaatttcattagaa 25792245  T
323 cttaaagagtgtccaccacatacgaacaccggatacaacacatacatttagacactgatagtaatttaagaaaatataagtgaatcagtgattgaaagta 422  Q
25792246 cttaaagagtgtccaccacatacgaacaccggatacaacacatacatttagacactgatagtaatttaagaaaatataagtgaatcagtgattgaaagta 25792345  T
423 accacgcacacgtgtcaatatcagacattgacatgtgtcggacaccagacacattttaatgtgaagtgtcggtgctacatactaattgataggtgttatg 522  Q
25792346 accacgcacacgtgtcaatatcagacattgacatgtgtcggacaccagacacattttaatgtgaagtgtcggtgctacatactaattgataggtgttatg 25792445  T
523 tgtatggcaaaatatgtggaccaatatgaaatatgattgtagttatatacataccatgaccctttccaacccttctcaattg 604  Q
25792446 tgtatggcaaaatatgtggaccaatatgaaatatgattgtagttatatacataccatgaccctttccaacccttctcaattg 25792527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 371 - 418
Target Start/End: Original strand, 21238713 - 21238760
371 tagacactgatagtaatttaagaaaatataagtgaatcagtgattgaa 418  Q
    |||||||||||| ||||||||||||||| |||||| | ||||||||||    
21238713 tagacactgataataatttaagaaaataaaagtgagtgagtgattgaa 21238760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 451 - 504
Target Start/End: Original strand, 15365611 - 15365664
451 tgacatgtgtcggacaccagacacattttaatgtgaagtgtcggtgctacatac 504  Q
    ||||| ||||||||||||||||||| ||||||||  ||||||  ||||||||||    
15365611 tgacacgtgtcggacaccagacacactttaatgtatagtgtcactgctacatac 15365664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 1059284 times since January 2019
Visitors: 949