View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9140J-LTR4-TNT-insertion-3 (Length: 562)

Name: F9140J-LTR4-TNT-insertion-3
Description: F9140J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9140J-LTR4-TNT-insertion-3
F9140J-LTR4-TNT-insertion-3
[»] chr2 (3 HSPs)
chr2 (8-552)||(11809451-11809995)
chr2 (395-443)||(11802397-11802445)
chr2 (182-217)||(11802313-11802348)


Alignment Details
Target: chr2 (Bit Score: 520; Significance: 0; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 520; E-Value: 0
Query Start/End: Original strand, 8 - 552
Target Start/End: Original strand, 11809451 - 11809995
Alignment:
8 gttgacttgttgtttaaggtgcaagcaaataattccttaagatttaagaagcacgcatgtttccattttcatggtgtctaagaattgtattcgagtatgg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
11809451 gttgacttgttgtttaaggtgcaagcaaataattccttaagatttaagaagcacgcatgtttccattttcatggtttctaagaattgtattcgagtatgg 11809550  T
108 aagttaagaaatattatgctatgaagttgaatagaataatataaatgtggcaaattcttgatttgtttgtatactgattgtgaaatagatgatagtttaa 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11809551 aagttaagaaatattatgctatgaagttgaatagaataatataaatgtggcaaattcttgatttgtttgtatactgattgtgaaatagatgatagtttaa 11809650  T
208 gcatatgaagttggaccctagattttgttcttgcatgttggagtttctatctcactaataggtcatgcatgcaagttnnnnnnngaaagtagcttgaaaa 307  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
11809651 gcatatgaagttggaccctagattttgttcttgcatgttggagtttctatctcactaataggtcatgcatgcaagttaaaaaaagaaagtagcttgaaaa 11809750  T
308 tctcatccttgctagcctttattagatatgcaattgctctgtttcattcacatggtatttatagcagtgatcaccatcgtgatccataaacttcatgatg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11809751 tctcatccttgctagcctttattagatatgcaattgctctgtttcattcacatggtatttatagcagtgatcaccatcgtgatccataaacttcatgatg 11809850  T
408 gaaaatttagagagctaacttctcaaaagcattatggtatgtttggagtaaataaattgtactagtttcactttcatctatgatttatttttggcactgt 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11809851 gaaaatttagagagctaacttctcaaaagcattatggtatgtttggagtaaataaattgtactagtttcactttcatctatgatttatttttggcactgt 11809950  T
508 tttattatgtgaattcttcaaaacggcaactccagaaaactatta 552  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
11809951 tttattatgtgaattcttcaaaacggcaactccagaaaactatta 11809995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 395 - 443
Target Start/End: Original strand, 11802397 - 11802445
Alignment:
395 aaacttcatgatggaaaatttagagagctaacttctcaaaagcattatg 443  Q
    |||||||||||||||||||| ||| ||||||||| || |||||||||||    
11802397 aaacttcatgatggaaaattcagaaagctaacttttccaaagcattatg 11802445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 182 - 217
Target Start/End: Original strand, 11802313 - 11802348
Alignment:
182 tgattgtgaaatagatgatagtttaagcatatgaag 217  Q
    ||||||||||||| ||||||||||||||||||||||    
11802313 tgattgtgaaatatatgatagtttaagcatatgaag 11802348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC