View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9140J-LTR4-TNT-insertion-4 (Length: 180)

Name: F9140J-LTR4-TNT-insertion-4
Description: F9140J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9140J-LTR4-TNT-insertion-4
F9140J-LTR4-TNT-insertion-4
[»] chr4 (1 HSPs)
chr4 (7-171)||(42585757-42585921)


Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 7 - 171
Target Start/End: Complemental strand, 42585921 - 42585757
Alignment:
7 aaatttaaagttaaaataatatttacgagtacttttctcagaggaatatttatgagtatatacctaaaatggagaatttcacnnnnnnnnntggaaaatt 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||    
42585921 aaatttaaagttaaaataatatttacgagtacttttctcagaggaatatttatgagtatatacctaaaatggagaatttcacaaaaaaaaatggaaaatt 42585822  T
107 aaattattattttttgcttcggaaaattagttgtttgttttttaacaaaaataacctaacaattg 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42585821 aaattattattttttgcttcggaaaattagttgtttgttttttaacaaaaataacctaacaattg 42585757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98258 times since January 2019
Visitors: 2271