View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9140J-LTR4-TNT-insertion-9 (Length: 617)

Name: F9140J-LTR4-TNT-insertion-9
Description: F9140J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9140J-LTR4-TNT-insertion-9
F9140J-LTR4-TNT-insertion-9
[»] chr1 (22 HSPs)
chr1 (8-607)||(44918827-44919426)
chr1 (373-602)||(51251978-51252212)
chr1 (377-605)||(39256187-39256430)
chr1 (373-605)||(33910324-33910571)
chr1 (375-522)||(45692167-45692324)
chr1 (453-522)||(24910696-24910765)
chr1 (453-601)||(16529134-16529282)
chr1 (453-605)||(33474729-33474881)
chr1 (453-522)||(11899410-11899479)
chr1 (464-521)||(32954451-32954508)
chr1 (382-522)||(6722379-6722528)
chr1 (541-605)||(1160748-1160812)
chr1 (393-449)||(29390138-29390194)
chr1 (541-601)||(29389324-29389384)
chr1 (393-456)||(8211668-8211731)
chr1 (542-597)||(45692092-45692147)
chr1 (375-449)||(16529041-16529115)
chr1 (543-605)||(24910786-24910848)
chr1 (373-449)||(24910601-24910677)
chr1 (393-449)||(33474900-33474956)
chr1 (393-456)||(5154965-5155028)
chr1 (24-74)||(2891755-2891805)
[»] chr7 (31 HSPs)
chr7 (318-522)||(32823967-32824175)
chr7 (318-605)||(22366738-22367029)
chr7 (373-603)||(42910229-42910469)
chr7 (376-605)||(31876197-31876436)
chr7 (375-522)||(31982221-31982373)
chr7 (373-597)||(36921104-36921340)
chr7 (373-605)||(10069851-10070088)
chr7 (373-605)||(43429456-43429703)
chr7 (453-605)||(24360936-24361088)
chr7 (373-522)||(27054275-27054440)
chr7 (373-515)||(36509024-36509167)
chr7 (318-522)||(13852677-13852895)
chr7 (373-456)||(47903671-47903754)
chr7 (318-456)||(3211700-3211837)
chr7 (373-456)||(11205990-11206073)
chr7 (373-456)||(47070056-47070139)
chr7 (453-522)||(18672863-18672932)
chr7 (373-456)||(8768278-8768361)
chr7 (373-456)||(10672207-10672290)
chr7 (542-605)||(47903522-47903585)
chr7 (480-522)||(5932990-5933032)
chr7 (541-605)||(48675400-48675464)
chr7 (541-596)||(32823893-32823948)
chr7 (373-426)||(1335882-1335935)
chr7 (552-605)||(13852596-13852649)
chr7 (459-520)||(48675485-48675546)
chr7 (379-442)||(40849363-40849426)
chr7 (409-456)||(47204105-47204152)
chr7 (373-415)||(24360843-24360885)
chr7 (373-434)||(5933092-5933153)
chr7 (387-415)||(10070840-10070868)
[»] chr4 (28 HSPs)
chr4 (375-605)||(10218971-10219206)
chr4 (373-522)||(8176160-8176314)
chr4 (374-605)||(40899633-40899879)
chr4 (459-605)||(6333604-6333750)
chr4 (393-519)||(52345225-52345356)
chr4 (374-522)||(48996450-48996613)
chr4 (459-605)||(23937171-23937317)
chr4 (453-519)||(52345081-52345147)
chr4 (373-521)||(31301772-31301924)
chr4 (453-522)||(40806463-40806532)
chr4 (374-449)||(5261404-5261479)
chr4 (453-605)||(30193623-30193775)
chr4 (374-521)||(32137064-32137229)
chr4 (373-456)||(26477741-26477824)
chr4 (453-518)||(43630908-43630973)
chr4 (373-456)||(29640023-29640106)
chr4 (542-605)||(43630839-43630902)
chr4 (373-456)||(50570570-50570653)
chr4 (542-605)||(31301687-31301750)
chr4 (542-605)||(32136980-32137043)
chr4 (373-456)||(42558111-42558194)
chr4 (541-605)||(29639743-29639807)
chr4 (373-456)||(36078712-36078795)
chr4 (542-605)||(48996367-48996430)
chr4 (559-605)||(40806566-40806612)
chr4 (541-602)||(8176333-8176394)
chr4 (318-449)||(30193474-30193604)
chr4 (401-449)||(52345166-52345214)
[»] chr8 (20 HSPs)
chr8 (374-522)||(14549599-14549757)
chr8 (392-605)||(18169598-18169821)
chr8 (392-605)||(18633164-18633387)
chr8 (318-522)||(3682289-3682502)
chr8 (374-600)||(36827341-36827582)
chr8 (377-508)||(44673109-44673255)
chr8 (373-522)||(30392450-30392614)
chr8 (453-522)||(6200579-6200648)
chr8 (453-518)||(10661523-10661588)
chr8 (373-457)||(5802504-5802588)
chr8 (542-604)||(10661437-10661499)
chr8 (401-449)||(36909924-36909972)
chr8 (541-597)||(36910063-36910119)
chr8 (373-431)||(33069064-33069122)
chr8 (453-522)||(33068963-33069032)
chr8 (401-449)||(10661607-10661654)
chr8 (541-605)||(14549516-14549580)
chr8 (541-605)||(33068880-33068944)
chr8 (324-448)||(6200436-6200559)
chr8 (563-605)||(30392367-30392409)
[»] chr2 (21 HSPs)
chr2 (318-605)||(25297750-25298051)
chr2 (373-605)||(11376174-11376416)
chr2 (373-605)||(44979323-44979570)
chr2 (453-522)||(17916501-17916570)
chr2 (373-521)||(19936673-19936831)
chr2 (393-605)||(44035597-44035824)
chr2 (453-521)||(34910681-34910749)
chr2 (373-456)||(9811768-9811851)
chr2 (318-454)||(20420808-20420943)
chr2 (374-455)||(16579019-16579100)
chr2 (453-510)||(18360183-18360240)
chr2 (318-454)||(36412855-36412990)
chr2 (542-603)||(19936852-19936913)
chr2 (393-449)||(42785098-42785154)
chr2 (559-605)||(17916609-17916655)
chr2 (373-449)||(18360259-18360335)
chr2 (541-605)||(20420487-20420551)
chr2 (541-597)||(34910605-34910661)
chr2 (373-449)||(17916412-17916482)
chr2 (373-442)||(27301011-27301080)
chr2 (323-363)||(12841918-12841958)
[»] chr5 (35 HSPs)
chr5 (322-605)||(12680573-12680870)
chr5 (323-605)||(2226382-2226678)
chr5 (376-605)||(36103162-36103406)
chr5 (373-605)||(12165491-12165738)
chr5 (373-605)||(32520773-32521015)
chr5 (461-605)||(30265444-30265587)
chr5 (373-456)||(10174507-10174589)
chr5 (373-522)||(36176668-36176832)
chr5 (453-522)||(36176532-36176601)
chr5 (459-605)||(332930-333078)
chr5 (318-456)||(38334309-38334446)
chr5 (323-456)||(666831-666963)
chr5 (541-605)||(9161270-9161334)
chr5 (474-522)||(35893357-35893405)
chr5 (462-522)||(42545026-42545086)
chr5 (373-456)||(11917833-11917916)
chr5 (373-456)||(27885695-27885778)
chr5 (318-449)||(15068861-15068991)
chr5 (374-605)||(38433973-38434219)
chr5 (375-449)||(42545840-42545914)
chr5 (318-456)||(9161432-9161570)
chr5 (545-605)||(36176835-36176895)
chr5 (373-456)||(8409364-8409447)
chr5 (375-508)||(17084436-17084573)
chr5 (318-456)||(30002376-30002513)
chr5 (401-449)||(332857-332905)
chr5 (470-518)||(10174434-10174482)
chr5 (542-605)||(35893273-35893337)
chr5 (541-605)||(38334695-38334759)
chr5 (374-449)||(36176438-36176513)
chr5 (541-599)||(23781022-23781080)
chr5 (541-599)||(23867975-23868033)
chr5 (373-437)||(23781175-23781239)
chr5 (373-437)||(23868128-23868192)
chr5 (373-456)||(701595-701678)
[»] scaffold0059 (2 HSPs)
scaffold0059 (383-605)||(69093-69330)
scaffold0059 (383-522)||(77199-77353)
[»] chr3 (18 HSPs)
chr3 (376-605)||(6003944-6004188)
chr3 (393-600)||(32880599-32880816)
chr3 (375-599)||(35531712-35531946)
chr3 (453-605)||(50562224-50562376)
chr3 (433-522)||(39098309-39098398)
chr3 (373-505)||(48032689-48032836)
chr3 (452-605)||(21586488-21586641)
chr3 (324-449)||(27641722-27641846)
chr3 (318-456)||(10369639-10369776)
chr3 (453-522)||(33002888-33002957)
chr3 (541-605)||(43030714-43030778)
chr3 (373-454)||(35401782-35401863)
chr3 (373-456)||(33361341-33361424)
chr3 (373-456)||(51149280-51149363)
chr3 (541-604)||(33002806-33002869)
chr3 (541-605)||(27641899-27641963)
chr3 (393-456)||(34794952-34795015)
chr3 (542-604)||(39098227-39098289)
[»] chr6 (14 HSPs)
chr6 (373-605)||(35039486-35039733)
chr6 (401-605)||(33550611-33550830)
chr6 (453-605)||(13801620-13801772)
chr6 (459-521)||(10591210-10591272)
chr6 (453-522)||(15860098-15860167)
chr6 (376-522)||(25137515-25137675)
chr6 (373-456)||(10390588-10390671)
chr6 (373-456)||(12270934-12271017)
chr6 (541-605)||(10390757-10390821)
chr6 (374-456)||(5866631-5866713)
chr6 (547-605)||(25137432-25137490)
chr6 (393-449)||(10591297-10591353)
chr6 (541-597)||(15860024-15860080)
chr6 (542-588)||(10591143-10591189)
[»] scaffold0013 (2 HSPs)
scaffold0013 (373-605)||(106323-106570)
scaffold0013 (460-605)||(128930-129075)
[»] scaffold0029 (5 HSPs)
scaffold0029 (373-521)||(40122-40285)
scaffold0029 (453-521)||(47413-47481)
scaffold0029 (373-449)||(47318-47394)
scaffold0029 (541-605)||(40305-40369)
scaffold0029 (541-605)||(47501-47565)
[»] scaffold0308 (1 HSPs)
scaffold0308 (373-456)||(5465-5548)
[»] scaffold0204 (1 HSPs)
scaffold0204 (318-365)||(15099-15146)


Alignment Details
Target: chr1 (Bit Score: 504; Significance: 0; HSPs: 22)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 504; E-Value: 0
Query Start/End: Original strand, 8 - 607
Target Start/End: Complemental strand, 44919426 - 44918827
Alignment:
8 ggtataaggtttgtcgaactatgaggtattggttcgtgcgccggttataattagaattttgggtcgtatgtaatataaattaagtagttctagtttgtnn 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
44919426 ggtataaggtttgtcgaactatgaggtattggttcgtgcgccggttataattagaattttgggtcgtatgtaatataaattaagtagttctagtttgtaa 44919327  T
108 nnnnncgttaagtagttttagaaaacttatttcaacatttgatttttcgatttcatgaatacgaggatgtgaaggacatgaaggttagcactatttcggt 207  Q
         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44919326 aaaaacgttaagtagttttagaaaacttatttcaacatttgatttttcgatttcatgaatacgaggatgtgaaggacatgaaggttagcactatttcggt 44919227  T
208 acaagaactgaaacaatcatccatagaaaggggcaaagccccaaatagaaaaagagctaactaaactacaactaaactttgcaaaagaatatgccatata 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44919226 acaagaactgaaacaatcatccatagaaaggggcaaagccccaaatagaaaaagagctaactaaactacaactaaactttgcaaaagaatatgccatata 44919127  T
308 atttgcgtaacaactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||    
44919126 atttgcgtaacaactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtaaaaaaaccgcacttgatttggatgaattcggataacttttg 44919027  T
408 cactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacat 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44919026 cactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacat 44918927  T
508 agctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgatta 607  Q
    |||||||||||||||                  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44918926 agctcaagaataatcttttttgatttgatttttccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgatta 44918827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 373 - 602
Target Start/End: Original strand, 51251978 - 51252212
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccaga-----ccgcaaga 467  Q
    ||||| ||| || |||||||||||||| ||||||||| ||||| |||| ||| |||||||||||||||||||||||| ||||||| |     ||||||||    
51251978 ccgcatttggttcggatgaattcggatgacttttgcaatgaaccgcgcagttcggtttggtttgcggtttgcatctcagcaaccaaaccaacccgcaaga 51252077  T
468 ataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattc 567  Q
    ||||||||||||||||||||||||||||| | |||||||||||  || |||||||                  |||||||||| ||||||| ||||||||    
51252078 ataatgaatattacttaaacatgtactagcctaattacatagccaaataataatctcttttgattcgatttttccattgttgcaccatcaaattcgattc 51252177  T
568 taattcttttccatctctttcgattcatttccagt 602  Q
    |||||| |||||||||||||| |||||||||||||    
51252178 taattcctttccatctctttcaattcatttccagt 51252212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 377 - 605
Target Start/End: Original strand, 39256187 - 39256430
Alignment:
377 acttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc---------------aaccagacc 461  Q
    ||||| || ||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||||| ||               ||||| |||    
39256187 acttggttcggatgaatttggatgacttttgcactgaactgcgcggtttggttcggtttgcggtttgcatctcagcaaccgaaccaaaccaaaccaaacc 39256286  T
462 gcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagtt 561  Q
    ||||||||||||||||||||||||||||||||||| | |||||||||||||| ||||||||                  |||||||||| |||||| |||    
39256287 gcaagaataatgaatattacttaaacatgtactagccaaattacatagctcacgaataatctttttcgattcgatttttccattgttgcaccatcaggtt 39256386  T
562 cgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||||| |||||||||||||| ||||||||||| ||||    
39256387 cgattctaattcctttccatctctttcaattcatttccaatgat 39256430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 373 - 605
Target Start/End: Original strand, 33910324 - 33910571
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctg---------------caacca 457  Q
    ||||||||| || ||||||||| |||| ||||||||||||||| |||||||| |||||||||||||||||||||||| |                |||||    
33910324 ccgcacttggttcggatgaatttggatgacttttgcactgaaccgcgcggttcggtttggtttgcggtttgcatctcagtaatcaaaccaaaccaaacca 33910423  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatca 557  Q
     |||||||||||||||||||||||||||| ||||||||| ||||||||||| || ||||||||||                  ||| |||||| ||||||    
33910424 aaccgcaagaataatgaatattacttaaatatgtactagcccaattacataacttaagaataatctcttttgattcgatttttccaatgttgcaccatca 33910523  T
558 agttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
     |||||||||||||||||||||||||||||| ||||||||| ||||||    
33910524 ggttcgattctaattcttttccatctctttcaattcatttcaagtgat 33910571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 375 - 522
Target Start/End: Complemental strand, 45692324 - 45692167
Alignment:
375 gcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc----------agaccgca 464  Q
    ||||||| || ||||||||| |||| ||||||||||||||| || ||||| |||| ||||||||||||||||||| ||||||          | ||||||    
45692324 gcacttggttcggatgaatttggatgacttttgcactgaaccgcacggttcggttcggtttgcggtttgcatctcagcaaccgaaccaaaacaaaccgca 45692225  T
465 agaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    |||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||||    
45692224 agaataataaatattacttaaatatgtactagtccaattacataactcaagaataatc 45692167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 453 - 522
Target Start/End: Original strand, 24910696 - 24910765
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
24910696 aaccaaaccggaagaataatgaatattacttaaacatgtactagcccaattacatagctcaagaataatc 24910765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 453 - 601
Target Start/End: Original strand, 16529134 - 16529282
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctc 552  Q
    ||||| |||||||||||| ||||||||||||||||||||| ||| ||||||||||||| |||||||||||                   ||||||||| |    
16529134 aaccaaaccgcaagaatagtgaatattacttaaacatgtaatagcccaattacatagcccaagaataatctcttttgattcgaatttttcattgttgcac 16529233  T
553 catcaagttcgattctaattcttttccatctctttcgattcatttccag 601  Q
    ||||| ||||||||||||||| |||||||||||||| ||||||||||||    
16529234 catcaggttcgattctaattcctttccatctctttcaattcatttccag 16529282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 453 - 605
Target Start/End: Complemental strand, 33474881 - 33474729
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctc 552  Q
    ||||| || |||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||                   |||||||||      
33474881 aaccaaactgcaagaataacgaatattacttaaatatgtactagcccaattacatagctcaagaataatctcttttgatttgattttttcattgttgcgt 33474782  T
553 catcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||| ||||||||||||||| |||||||||||||| ||||||||||||||||    
33474781 catcaggttcgattctaattcctttccatctctttcaattcatttccagtgat 33474729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 453 - 522
Target Start/End: Complemental strand, 11899479 - 11899410
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| |||||||||||||||||||||||||||| |||||||||  ||||||||||||||||||||||||    
11899479 aaccaaaccgcaagaataatgaatattacttaaatatgtactagctcaattacatagctcaagaataatc 11899410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 464 - 521
Target Start/End: Complemental strand, 32954508 - 32954451
Alignment:
464 aagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
    |||||||||||||||||||||||||||||| || ||||||||||||||||||||||||    
32954508 aagaataatgaatattacttaaacatgtacaagcccaattacatagctcaagaataat 32954451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 382 - 522
Target Start/End: Original strand, 6722379 - 6722528
Alignment:
382 atttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc----------agaccgcaagaataa 471  Q
    |||| |||||||| |||| ||||||||| ||||||  |||||| | || | ||||||||||||||||| ||||||          | ||||||||| |||    
6722379 atttagatgaatttggatgacttttgcattgaactttgcggttcgattcgatttgcggtttgcatctcagcaaccgaaccaaaccaaaccgcaaga-taa 6722477  T
472 tgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    |||||||||||||||||||||||   |||||||||||||||||||||||||    
6722478 tgaatattacttaaacatgtactgacccaattacatagctcaagaataatc 6722528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 541 - 605
Target Start/End: Original strand, 1160748 - 1160812
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||  ||||| || |||||||||||| |||||||||||||| ||||||||||||||||    
1160748 ccattgttgcaacatcaggtacgattctaattcctttccatctctttcaattcatttccagtgat 1160812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 393 - 449
Target Start/End: Complemental strand, 29390194 - 29390138
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||| ||||||||||||||| |||||||| |||| |||||||||||||||||||    
29390194 ttcggatgacttttgcactgaaccgcgcggttcggttcggtttgcggtttgcatctc 29390138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 541 - 601
Target Start/End: Complemental strand, 29389384 - 29389324
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccag 601  Q
    |||||||||| |||||| ||||||||||||||| | |||||||||||| | ||||||||||    
29389384 ccattgttgcaccatcaggttcgattctaattcctctccatctctttcaactcatttccag 29389324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 393 - 456
Target Start/End: Complemental strand, 8211731 - 8211668
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
8211731 ttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 8211668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 542 - 597
Target Start/End: Complemental strand, 45692147 - 45692092
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcattt 597  Q
    ||||||||| |||| | ||||||||||||||| |||||||||||||| ||||||||    
45692147 cattgttgcaccattaggttcgattctaattcctttccatctctttcaattcattt 45692092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 375 - 449
Target Start/End: Original strand, 16529041 - 16529115
Alignment:
375 gcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||| || | ||||||||||||  |||||||||||||| |||| ||| ||||| || |||||||||||||||    
16529041 gcacttggttcgtatgaattcggatggcttttgcactgaacagcgcagttcggtttagtatgcggtttgcatctc 16529115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 543 - 605
Target Start/End: Original strand, 24910786 - 24910848
Alignment:
543 attgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||| |||||| ||||||||||||||  ||||||||||| || ||||||||| ||||||    
24910786 attgttgcaccatcaggttcgattctaatttctttccatctctctcaattcatttcgagtgat 24910848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 373 - 449
Target Start/End: Original strand, 24910601 - 24910677
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||||| || |||||||||||||| ||||||||| ||||| | || ||| ||||  ||||| ||||||||||||    
24910601 ccgcacttggttcggatgaattcggatgacttttgcattgaaccgtgcagttcggttcagtttgtggtttgcatctc 24910677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 393 - 449
Target Start/End: Complemental strand, 33474956 - 33474900
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||| ||||||||||||||| |||||||| |||| |||||| | ||||||||||    
33474956 ttcggatgacttttgcactgaaccgcgcggttcggttcggtttgtgatttgcatctc 33474900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 456
Target Start/End: Original strand, 5154965 - 5155028
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| ||||||  ||||||| || ||||| |||| ||||||||||||||||||| ||||||    
5154965 ttcggatgacttttagactgaaccgcacggttcggttcggtttgcggtttgcatctcagcaacc 5155028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 24 - 74
Target Start/End: Original strand, 2891755 - 2891805
Alignment:
24 aactatgaggtattggttcgtgcgccggttataattagaattttgggtcgt 74  Q
    |||||||||||||| |||| |||| |||| | |||||||||||||||||||    
2891755 aactatgaggtattagttcatgcgtcggtcacaattagaattttgggtcgt 2891805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 100; Significance: 4e-49; HSPs: 31)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 318 - 522
Target Start/End: Complemental strand, 32824175 - 32823967
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| | ||||||||||||| |||||| ||||||||       ||||||||| |||||||||||||||||  |||||||||||||| |    
32824175 caacccaatagaaaaaccacaaatcaaatcaatccaaatcgaaaccgtaaaaaa-ccgcacttggtttggatgaattcggatggcttttgcactgaaccg 32824077  T
418 cgcggtttggtttggtttgcggtttgcatctctgc-----aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctc 512  Q
    | ||||| |||| ||||||||||||||||||| ||     ||||| |||||| ||||||||||||||||||||||||||||||| |||||||||||||||    
32824076 cacggttcggttcggtttgcggtttgcatctcagcaaccaaaccaaaccgcatgaataatgaatattacttaaacatgtactagcccaattacatagctc 32823977  T
513 aagaataatc 522  Q
    ||||||||||    
32823976 aagaataatc 32823967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 318 - 605
Target Start/End: Complemental strand, 22367029 - 22366738
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||| ||||| ||||||||||| ||| |||||| |||||||        ||||||||| ||  ||||||||||||| ||||||||||| ||| |    
22367029 caacccaataaaaaaaccgcaaatcaaaccaatccaaatcgaaaccg-caaaaaaccgcacttggttcagatgaattcggatgacttttgcactaaaccg 22366931  T
418 cgcggtttggtttggtttgcggtttgcatctctgc-----aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctc 512  Q
     ||| ||||||| ||||||||||||||||||  ||     ||||| |||||||||||||||||||||||| ||||||||||||| |||||||||||||||    
22366930 tgcgatttggttcggtttgcggtttgcatcttagcaaccaaaccaaaccgcaagaataatgaatattactcaaacatgtactagcccaattacatagctc 22366831  T
513 aagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||                  |||||||||| |||||| ||||||||||||||| |||||||||||||| ||||||||||||||||    
22366830 aagaataatctctttcaattcggtttttccattgttgcaccatcaggttcgattctaattcctttccatctctttcaattcatttccagtgat 22366738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 373 - 603
Target Start/End: Original strand, 42910229 - 42910469
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc----------agaccg 462  Q
    ||||||||| || |||||||||||||| ||||||||||||||| | |||||| |||| ||||||||||||||||||| ||||||          | ||||    
42910229 ccgcacttggttcggatgaattcggatgacttttgcactgaaccgtgcggttcggttcggtttgcggtttgcatctcagcaaccgaaccaaaccaaaccg 42910328  T
463 caagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttc 562  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||                  |||||||||| |||||| || |    
42910329 caagaataatgaatattacttaaacatgtactagcccaattacatagctcaagaataatctcttttgatttgatttttccattgttgcaccatcaggtcc 42910428  T
563 gattctaattcttttccatctctttcgattcatttccagtg 603  Q
    ||||||||||| |||||||||||||| ||||||||||||||    
42910429 gattctaattcctttccatctctttcaattcatttccagtg 42910469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 376 - 605
Target Start/End: Original strand, 31876197 - 31876436
Alignment:
376 cacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagacc----------gcaa 465  Q
    ||||||||| |||||||||||||| ||||||||| ||||| | |||||| | |||||||||||||||||||||| ||||||| |||          ||||    
31876197 cacttgattcggatgaattcggatgacttttgcaatgaaccgtgcggttcgatttggtttgcggtttgcatctcagcaaccaaaccaaaccaaaccgcaa 31876296  T
466 gaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgat 565  Q
     |||||||||||||||||||||||||||||| ||| |||||||||||||||||||||                  |||||||||| ||||||  ||||||    
31876297 aaataatgaatattacttaaacatgtactagcccagttacatagctcaagaataatctcttttaattcgatttttccattgttgcaccatcagattcgat 31876396  T
566 tctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||||||||||||||  ||||||||||||||||    
31876397 tctaattcttttccatctcttttaattcatttccagtgat 31876436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 375 - 522
Target Start/End: Original strand, 31982221 - 31982373
Alignment:
375 gcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc-----aaccagaccgcaagaat 469  Q
    |||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||  ||     ||||| ||||||| |||    
31982221 gcacttgattcggatgaattcagatgacttttgcactgaactgcgcggtttggtttgatttgcggtttgcatcttagcaaccaaaccaaaccgcaaaaat 31982320  T
470 aatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||| |||||||||||||  ||||| || ||||||||||||| |||||||||||    
31982321 aatcaatattacttaaatttgtaccagcccaattacatagcccaagaataatc 31982373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 373 - 597
Target Start/End: Original strand, 36921104 - 36921340
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc----------agaccg 462  Q
    ||||||||| || |||||||||||||| ||||||||| |||||  ||||||| |||||||||||| ||||||||||| ||||||          | ||||    
36921104 ccgcacttggttcggatgaattcggattacttttgcattgaaccacgcggttcggtttggtttgcagtttgcatctcagcaaccgaaccaaaccaaaccg 36921203  T
463 caagaataatgaatattacttaaacatgtacta--gtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagt 560  Q
    |||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||                   ||||||||| |||||| ||    
36921204 caagaataatgaatattacttaaacatgtactaacccccaattacatagctcaagaataatcgcttttgattcgattttttcattgttgcaccatcaggt 36921303  T
561 tcgattctaattcttttccatctctttcgattcattt 597  Q
    |||||||||||||||||||||||||||| ||||||||    
36921304 tcgattctaattcttttccatctctttcaattcattt 36921340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 373 - 605
Target Start/End: Complemental strand, 10070088 - 10069851
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc-----aaccagaccgcaaga 467  Q
    ||||||||| || |||||||||||||| ||||||||||||||| || | |||  ||| |||||||| |||||||||| ||     ||||| |||||||||    
10070088 ccgcacttggttcggatgaattcggatgacttttgcactgaaccgcacagttcagttcggtttgcgatttgcatctcagcaaccaaaccaaaccgcaaga 10069989  T
468 ataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattc 567  Q
    ||||| |||||||||||||| |||||  | ||||||||||||| |||||||||||                  |||||||||| |||||| ||| |||||    
10069988 ataatcaatattacttaaacttgtaccggcccaattacatagcccaagaataatcttttttgatttgatttttccattgttgcaccatcaggtttgattc 10069889  T
568 taattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||| |||||||||| ||| ||||||||||| ||||    
10069888 taattcctttccatctccttcaattcatttccaatgat 10069851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 373 - 605
Target Start/End: Complemental strand, 43429703 - 43429456
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------a 457  Q
    ||||||||| || |||||||||||||| ||||||||||| ||| ||  |||| |||| ||||||||||||||||||| ||||||               |    
43429703 ccgcacttggttcggatgaattcggatgacttttgcactaaaccgcatggttcggttcggtttgcggtttgcatctcagcaaccgaaccaaaccaaacca 43429604  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatca 557  Q
     |||||||||||||||| |||||||||||| |||||| |||||||||||||||||||||| ||||                  |||||||||| ||||||    
43429603 aaccgcaagaataatgactattacttaaacgtgtactcgtccaattacatagctcaagaaaaatctcttttgattcgatttttccattgttgcaccatca 43429504  T
558 agttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
     |||| |||||||||| |||||||||||||||||||||||||| ||||    
43429503 ggttcaattctaattcctttccatctctttcgattcatttccaatgat 43429456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 453 - 605
Target Start/End: Original strand, 24360936 - 24361088
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctc 552  Q
    ||||| |||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||||||                   ||||||||| |    
24360936 aaccaaaccgcaagaataatgactattacttaaatatgtactagcccaattacatagctcaagaataatcccttttgattcgattttttcattgttgcac 24361035  T
553 catcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||| |||||||||| ||||||| |||||| ||||||||||||||||    
24361036 catcaagttcaattctaattcctttccatttctttcaattcatttccagtgat 24361088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 373 - 522
Target Start/End: Original strand, 27054275 - 27054440
Alignment:
373 ccgcacttgattt-ggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaa---------------cc 456  Q
    ||||||||| ||| |||||||||| ||| ||||||||||| ||| | ||| |||||||||||||||||||||||| || ||||               ||    
27054275 ccgcacttggtttcggatgaattcagatgacttttgcactaaaccgtgcgatttggtttggtttgcggtttgcatatcagcaatcgaaccaaaccaaacc 27054374  T
457 agaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    | ||| |||||||||||||||||||||||| ||||||||| ||||||||||| |||||||||||||    
27054375 aaaccacaagaataatgaatattacttaaatatgtactagcccaattacataactcaagaataatc 27054440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 373 - 515
Target Start/End: Complemental strand, 36509167 - 36509024
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttg-catctctgcaaccagaccgcaagaataa 471  Q
    ||||||||| || ||||||||||  || ||||||||| ||||| | |||||| |||||||||||||||||| || |  |  ||||| |||||||||||||    
36509167 ccgcacttggttcggatgaattcatatgacttttgcattgaaccgtgcggttcggtttggtttgcggtttgtcagcaatcgaaccaaaccgcaagaataa 36509068  T
472 tgaatattacttaaacatgtactagtccaattacatagctcaag 515  Q
    | |||||||||||||  ||||| || ||||||||||||| ||||    
36509067 tcaatattacttaaatttgtacgagcccaattacatagcccaag 36509024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 318 - 522
Target Start/End: Complemental strand, 13852895 - 13852677
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||| |||| ||| ||||||||||||||        | ||||||| || |||||||||||||| ||||||||||||||| |    
13852895 caacccaatagaaaaaccgcaaaccaaaccaaaccaaattgaaaccg-caaaaaacagcacttggttcggatgaattcggatgacttttgcactgaaccg 13852797  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaac---------------cagaccgcaagaataatgaatattacttaaacatgtactagtccaat 502  Q
     | |||| ||||  |||||||||||||||||| |||||               || || ||||||||||||||||||| ||||| ||||||||   ||||    
13852796 agtggttcggttctgtttgcggtttgcatctcagcaactgaaccaaaccaaaccaaactgcaagaataatgaatattatttaaatatgtactaactcaat 13852697  T
503 tacatagctcaagaataatc 522  Q
    ||||||||||||||||||||    
13852696 tacatagctcaagaataatc 13852677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 47903754 - 47903671
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||||||||||| ||||||||||||||| |||| ||| | || ||||||||||||||||||| ||||||    
47903754 ccgcacttggttcggatgaattcggatgacttttgcactgaaccgcgcagttcgtttcggtttgcggtttgcatctcagcaacc 47903671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 318 - 456
Target Start/End: Original strand, 3211700 - 3211837
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||| | || |||||||||| |||||||        ||||||||| || |||||| ||||||| ||||||  ||||||| |    
3211700 caacccaatagaaaaaccgcaaaccgaaccaacccaaatcgaaaccg-caaaaaaccgcacttggttcggatgagttcggatgacttttagactgaaccg 3211798  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| |||| ||||||||||||||||||| ||||||    
3211799 cgcggttcggttcggtttgcggtttgcatctcagcaacc 3211837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 11205990 - 11206073
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
11205990 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 11206073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 47070139 - 47070056
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
47070139 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 47070056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 453 - 522
Target Start/End: Original strand, 18672863 - 18672932
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| ||||||| |||||| |||||||||||||| |||||||| ||||||||||||| || ||||||||    
18672863 aaccaaaccgcaataataatcaatattacttaaacttgtactagcccaattacatagcacaggaataatc 18672932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 8768278 - 8768361
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| |||||| |||||||||||| ||||||    
8768278 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgtggtttgcatctcagcaacc 8768361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 10672290 - 10672207
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| | |||||| |||| ||||||||||||||||||| ||||||    
10672290 ccgcacttggttcggatgagttcggatgacttttagactgaaccgtgcggttcggttcggtttgcggtttgcatctcagcaacc 10672207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 542 - 605
Target Start/End: Complemental strand, 47903585 - 47903522
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||| |||||| |||||||| |||||| ||||||| |||||| ||||||||||||||||    
47903585 cattgttgcaccatcaggttcgattataattcatttccatatctttcaattcatttccagtgat 47903522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 480 - 522
Target Start/End: Complemental strand, 5933032 - 5932990
Alignment:
480 acttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||||||||||||||| |||||||||||||||||||||||||    
5933032 acttaaacatgtactagcccaattacatagctcaagaataatc 5932990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 541 - 605
Target Start/End: Complemental strand, 48675464 - 48675400
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||| |||||| ||| ||||||||||| |||||||||||||  |||||||| |||||||    
48675464 ccattgttgcaccatcaggtttgattctaattcatttccatctctttgaattcattttcagtgat 48675400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 596
Target Start/End: Complemental strand, 32823948 - 32823893
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatt 596  Q
    |||||||||| |||||| ||||||||||||||| ||||||||| |||| |||||||    
32823948 ccattgttgcaccatcaggttcgattctaattcctttccatctatttcaattcatt 32823893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 373 - 426
Target Start/End: Complemental strand, 1335935 - 1335882
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttg 426  Q
    ||||||||| ||||||||||||| ||| ||||||||||| ||| ||||||||||    
1335935 ccgcacttggtttggatgaattcagatgacttttgcactaaaccgcgcggtttg 1335882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 552 - 605
Target Start/End: Complemental strand, 13852649 - 13852596
Alignment:
552 ccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||| |||||||| |||||| |||||||||||||| |||||||| |||||||    
13852649 ccatcaggttcgattataattcctttccatctctttcaattcatttacagtgat 13852596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 459 - 520
Target Start/End: Complemental strand, 48675546 - 48675485
Alignment:
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataa 520  Q
    |||| ||||||||| ||||||||||||||||||| ||| | |||||||||||| || |||||    
48675546 accgtaagaataataaatattacttaaacatgtattagcctaattacatagctaaaaaataa 48675485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 379 - 442
Target Start/End: Complemental strand, 40849426 - 40849363
Alignment:
379 ttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggttt 442  Q
    |||||||||||| |||||||| ||||||  ||| ||| ||  ||||||||||||||||||||||    
40849426 ttgatttggatgtattcggatcacttttttactcaaccgcatggtttggtttggtttgcggttt 40849363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 409 - 456
Target Start/End: Original strand, 47204105 - 47204152
Alignment:
409 actgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
47204105 actgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 47204152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 373 - 415
Target Start/End: Original strand, 24360843 - 24360885
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaac 415  Q
    ||||||||| ||||||||||||||||| |||||||||| ||||    
24360843 ccgcacttggtttggatgaattcggatgacttttgcacagaac 24360885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 434
Target Start/End: Complemental strand, 5933153 - 5933092
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtt 434  Q
    ||||||||| || |||| ||||| ||| ||||||||||||||| |||||||| |||| ||||    
5933153 ccgcacttggttcggataaattcagatgacttttgcactgaaccgcgcggttcggttcggtt 5933092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 387 - 415
Target Start/End: Original strand, 10070840 - 10070868
Alignment:
387 gatgaattcggataacttttgcactgaac 415  Q
    |||||||||||||||||||||||||||||    
10070840 gatgaattcggataacttttgcactgaac 10070868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 89; Significance: 1e-42; HSPs: 28)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 375 - 605
Target Start/End: Complemental strand, 10219206 - 10218971
Alignment:
375 gcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc---tgc--aaccagaccgcaagaat 469  Q
    ||||||| || | ||||| |||||| |||||| |||||||| |||||||| ||||||||||||||||||||||||   | |  ||||| |||||||||||    
10219206 gcacttggttcgaatgaactcggatgacttttacactgaaccgcgcggttcggtttggtttgcggtttgcatctcaagtaccaaaccaaaccgcaagaat 10219107  T
470 aatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattcta 569  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||                  |||||||||| |||||  |||||||||||    
10219106 aatgaatattacttaaacatgtactagcccaattacatagctcaagaataatctcatttgattagatttttccattgttgcaccatctggttcgattcta 10219007  T
570 attcttttccatctctttcgattcatttccagtgat 605  Q
    |||| |||||||||||||| |||||||| |||||||    
10219006 attcctttccatctctttcaattcattttcagtgat 10218971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 373 - 522
Target Start/End: Original strand, 8176160 - 8176314
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc-----aaccagaccgcaaga 467  Q
    ||||||||| || ||||||| ||| || ||||||||||||||| |||  ||| |||| | ||||||||||||||||| ||     ||||| |||||||||    
8176160 ccgcacttggttcggatgaactcgaatgacttttgcactgaaccgcgtcgttcggttcgatttgcggtttgcatctcagcaaccaaaccaaaccgcaaga 8176259  T
468 ataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    |||||||| |||||||||||||||||||| ||||||||||||| ||| |||||||    
8176260 ataatgaagattacttaaacatgtactagcccaattacatagcccaaaaataatc 8176314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 374 - 605
Target Start/End: Original strand, 40899633 - 40899879
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc---------------aaccag 458  Q
    |||||||| || |||||||||||||| |||||||| |||||| ||||||||||||| ||||||||||||||||||| ||               |||||     
40899633 cgcacttggttcggatgaattcggatgacttttgcgctgaaccgcgcggtttggttcggtttgcggtttgcatctcagcaaccgaaccaaaccaaaccaa 40899732  T
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaa 558  Q
    |||||||||||||||||| ||||||||||||||| ||| ||||||||||||| |||| ||||||                  |||||||||| |||||||    
40899733 accgcaagaataatgaatgttacttaaacatgtaatagcccaattacatagcccaaggataatctcttttgattcgatttttccattgttgcaccatcaa 40899832  T
559 gttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
     ||| |||||||||| |||||||||||||  ||||||||||||||||    
40899833 attcaattctaattcctttccatctctttaaattcatttccagtgat 40899879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 459 - 605
Target Start/End: Complemental strand, 6333750 - 6333604
Alignment:
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaa 558  Q
    |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||                  |||| ||||| ||||||     
6333750 accgcaagaataatgaatattacttaaatatgtactagcccaattacatagctcaagaataatctcttttgattcaatttttccatcgttgcaccatcag 6333651  T
559 gttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||||||| |||||||||||||| ||||||||||||||||    
6333650 gttcgattctaattcatttccatctctttcaattcatttccagtgat 6333604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 393 - 519
Target Start/End: Complemental strand, 52345356 - 52345225
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc-----agaccgcaagaataatgaatattacttaaac 487  Q
    ||||||| ||||||| ||||||  ||  |||| |||| |||||| |||||||||||| ||||||     | |||||||||||||||||||||||||||||    
52345356 ttcggatgacttttgtactgaatcgcatggttcggttcggtttgtggtttgcatctcagcaaccgaaccaaaccgcaagaataatgaatattacttaaac 52345257  T
488 atgtactagtccaattacatagctcaagaata 519  Q
    ||||||||| |||||| |||||||||||||||    
52345256 atgtactagcccaattgcatagctcaagaata 52345225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 374 - 522
Target Start/End: Complemental strand, 48996613 - 48996450
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------ag 458  Q
    |||||||| || |||| ||||||||| ||||||||| ||||| |||||||| |||||| ||||||||||||||||| ||||||               |     
48996613 cgcacttggttcggatcaattcggatgacttttgcaatgaaccgcgcggttcggtttgatttgcggtttgcatctcagcaaccgaaccaaaccaaaccaa 48996514  T
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    |||||||||||||||||||||||||||||||||||||| | |||||||||||  ||||||||||    
48996513 accgcaagaataatgaatattacttaaacatgtactagcctaattacatagcctaagaataatc 48996450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 459 - 605
Target Start/End: Original strand, 23937171 - 23937317
Alignment:
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaa 558  Q
    |||||||||||||| |||||||||||||||| |||||||||||||||||| |||||||||||||                  |||||||||| ||||||     
23937171 accgcaagaataataaatattacttaaacatatactagtccaattacataactcaagaataatctctttagatttgatttttccattgttgcaccatcat 23937270  T
559 gttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||| |||||||||| |||||||||||||| ||||||||| ||||||    
23937271 gttctattctaattcctttccatctctttcaattcatttctagtgat 23937317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 453 - 519
Target Start/End: Complemental strand, 52345147 - 52345081
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaata 519  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||    
52345147 aaccaaaccgcaagaataatgaatattacttaaacatgtactagtccgattgcatagctcaagaata 52345081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 373 - 521
Target Start/End: Complemental strand, 31301924 - 31301772
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc-----agaccgcaaga 467  Q
    ||||||||| || |||||||||| ||| |||||| ||||||||  |  ||||  ||| ||||||||||||||||||| ||||||     | |||||||||    
31301924 ccgcacttggttcggatgaattcagatgactttt-cactgaaccacatggttcagttcggtttgcggtttgcatctcagcaaccgaaccaaaccgcaaga 31301826  T
468 ataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
    ||||| |||||||||||||| |||| ||| ||||||||||| ||||||||||||    
31301825 ataatcaatattacttaaacttgtattagcccaattacataactcaagaataat 31301772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 453 - 522
Target Start/End: Original strand, 40806463 - 40806532
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| |||||||||||||||||||||||||||| |||||||||  ||||||||||||||||||||||||    
40806463 aaccaaaccgcaagaataatgaatattacttaaatatgtactagctcaattacatagctcaagaataatc 40806532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 374 - 449
Target Start/End: Original strand, 5261404 - 5261479
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||||||| |||||||||| ||| ||||||||||||||| |||||||| |||| |||||||||||||||||||    
5261404 cgcacttgattcggatgaattcagatgacttttgcactgaaccgcgcggttcggttcggtttgcggtttgcatctc 5261479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 453 - 605
Target Start/End: Original strand, 30193623 - 30193775
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctc 552  Q
    ||||| |||||||||||||||||||||||||||| ||||| ||  ||||||||||||||||||||||||                   |||||||||| |    
30193623 aaccataccgcaagaataatgaatattacttaaatatgtattatcccaattacatagctcaagaataatttcttttgattcgatttttccattgttgcac 30193722  T
553 catcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||| |||||||| |||||| |||||||||||||| |||||||| |||||||    
30193723 catcaggttcgattttaattcctttccatctctttcaattcatttacagtgat 30193775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 374 - 521
Target Start/End: Complemental strand, 32137229 - 32137064
Alignment:
374 cgcacttgatttggatgaatt---cggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc-------------- 456  Q
    ||||||||||| |||||||||   | ||| ||||||||| ||||| | |||||| |||||||||||||||||||||||| ||||||                  
32137229 cgcacttgattcggatgaatttttcagatgacttttgcaatgaaccgtgcggttcggtttggtttgcggtttgcatctcagcaaccgaaccaaatcaaac 32137130  T
457 -agaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
     | ||| ||||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||    
32137129 caaaccacaagaatgatgaatattacttaaacatgtactagcccaattacatagcttaagaataat 32137064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 26477741 - 26477824
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||||||||||| ||||||| ||| ||| | |||||| |||||||||||||||||||||||| ||||||    
26477741 ccgcacttggttcggatgaattcggatgacttttgtactaaaccgtgcggttcggtttggtttgcggtttgcatctcagcaacc 26477824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 453 - 518
Target Start/End: Complemental strand, 43630973 - 43630908
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaat 518  Q
    ||||| |||||||||||||||||||||||||||| ||||| ||| |||| ||||||||||||||||    
43630973 aaccaaaccgcaagaataatgaatattacttaaaaatgtaatagcccaactacatagctcaagaat 43630908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 29640106 - 29640023
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
29640106 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 29640023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 542 - 605
Target Start/End: Complemental strand, 43630902 - 43630839
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||| |||| ||||||||||||||||| |||||||||||||| |||||||| |||||||    
43630902 cattgttgcaccattaagttcgattctaattcctttccatctctttcaattcatttgcagtgat 43630839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 50570570 - 50570653
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
50570570 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 50570653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 542 - 605
Target Start/End: Complemental strand, 31301750 - 31301687
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||| ||||||  |||||||||||||| |||||||||| ||| ||||||||||||||||    
31301750 cattgttgcaccatcagtttcgattctaattcatttccatctccttcaattcatttccagtgat 31301687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 542 - 605
Target Start/End: Complemental strand, 32137043 - 32136980
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||| |||||| |||||||| |||||| |||||||||||||| ||||||||| ||||||    
32137043 cattgttgcaccatcaggttcgattttaattcctttccatctctttcaattcatttcaagtgat 32136980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 42558194 - 42558111
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| | |||||| |||| ||||||||||||||||||| ||||||    
42558194 ccgcacttggttcggatgagttcggatgacttttagactgaaccgtgcggttcggttcggtttgcggtttgcatctcagcaacc 42558111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 541 - 605
Target Start/End: Complemental strand, 29639807 - 29639743
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||  ||||| ||||||||||||||| |||||||||| ||| ||||||||||| ||||    
29639807 ccattgttgcatcatcaggttcgattctaattcctttccatctccttcaattcatttccaatgat 29639743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 36078795 - 36078712
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| ||||  |||||| ||||||||||| ||||||    
36078795 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcagtttgcagtttgcatctcagcaacc 36078712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 542 - 605
Target Start/End: Complemental strand, 48996430 - 48996367
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||| ||||||| |||||||||||||| |||||| ||||||| ||| |||| |||||||    
48996430 cattgttgcaccatcaaattcgattctaattcctttccacctctttcaatttattttcagtgat 48996367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 559 - 605
Target Start/End: Original strand, 40806566 - 40806612
Alignment:
559 gttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||||||| |||||||||||||| ||||||||||| ||||    
40806566 gttcgattctaattcctttccatctctttcaattcatttccaatgat 40806612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 541 - 602
Target Start/End: Original strand, 8176333 - 8176394
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagt 602  Q
    |||||||||| |||||| ||||||| ||||||| |||||||||||||  |||||||| ||||    
8176333 ccattgttgcaccatcaggttcgatcctaattcctttccatctcttttaattcattttcagt 8176394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 318 - 449
Target Start/End: Original strand, 30193474 - 30193604
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    ||||||||||||||||  ||||| |||| ||| |||||  ||||||||       |||||| ||||| ||||||||||| || ||||||||| ||||| |    
30193474 caactcaatagaaaaactgcaaaccaaaccaatccaaaccgaaaccgtaaaaaa-ccgcacatgattcggatgaattcgtatgacttttgcaatgaaccg 30193572  T
418 cgcggtttggtttggtttgcggtttgcatctc 449  Q
     |||||| ||||  |||||| |||||||||||    
30193573 tgcggttcggttcagtttgcagtttgcatctc 30193604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 401 - 449
Target Start/End: Complemental strand, 52345214 - 52345166
Alignment:
401 acttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||||||||||| || ||||| |||| |||||||||||||||||||    
52345214 acttttgcactgaaccgcacggttcggttcggtttgcggtttgcatctc 52345166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 84; Significance: 1e-39; HSPs: 20)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 374 - 522
Target Start/End: Complemental strand, 14549757 - 14549599
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgca----------accagaccgc 463  Q
    |||||||| || |||||||||||||| ||||||||||||||| |||||||| |||| ||||||||||||||||||| |||          |||| ||||     
14549757 cgcacttggttcggatgaattcggatgacttttgcactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcatccgaaccaaaccaaaccgt 14549658  T
464 aagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
14549657 aagaataatgaatattacttaaacatgtactagcccaattacatagctcaagaataatc 14549599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 392 - 605
Target Start/End: Original strand, 18169598 - 18169821
Alignment:
392 attcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagacc----------gcaagaataatgaatattac 481  Q
    |||||||| ||||||||||||||| ||| |||| |||||||||||||||||||||||| ||| ||  |||          ||||||||||||||||||||    
18169598 attcggattacttttgcactgaaccgcgtggttcggtttggtttgcggtttgcatctcggcagccgaaccaaatcaaactgcaagaataatgaatattac 18169697  T
482 ttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccat 581  Q
    ||||||||||||||| ||||||||||| |||||||||||||                  ||||| |||| |||||| ||| ||||||||||| |||||||    
18169698 ttaaacatgtactagcccaattacatacctcaagaataatctctatcgattcgatttttccattattgcaccatcaggtttgattctaattcctttccat 18169797  T
582 ctctttcgattcatttccagtgat 605  Q
    ||||||| ||||||||||||||||    
18169798 ctctttcaattcatttccagtgat 18169821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 392 - 605
Target Start/End: Original strand, 18633164 - 18633387
Alignment:
392 attcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagacc----------gcaagaataatgaatattac 481  Q
    |||||||| ||||||||||||||| ||| |||| |||||||||||||||||||||||| ||| ||  |||          ||||||||||||||||||||    
18633164 attcggattacttttgcactgaaccgcgtggttcggtttggtttgcggtttgcatctcggcagccgaaccaaatcaaactgcaagaataatgaatattac 18633263  T
482 ttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccat 581  Q
    ||||||||||||||| ||||||||||| |||||||||||||                  ||||| |||| |||||| ||| ||||||||||| |||||||    
18633264 ttaaacatgtactagcccaattacatacctcaagaataatctctatcgattcgatttttccattattgcaccatcaggtttgattctaattcctttccat 18633363  T
582 ctctttcgattcatttccagtgat 605  Q
    ||||||| ||||||||||||||||    
18633364 ctctttcaattcatttccagtgat 18633387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 318 - 522
Target Start/End: Complemental strand, 3682502 - 3682289
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| ||||||||||| ||| ||||||  ||||||        ||||||||| ||   ||||| |||||| |||||| |||||||| |    
3682502 caacccaatagaaaaaccgcaaatcaaaccaatccaaatcaaaaccg-caaaaaaccgcacttggttcaaatgaaatcggatgacttttccactgaaccg 3682404  T
418 cgcggtttggtttggtttgcggtttgcatctctgc----------aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacat 507  Q
    |||||||||||||||||||||||||||||||| ||          ||||| ||||||||||||||||||||||| |||||||||||||| ||||||||||    
3682403 cgcggtttggtttggtttgcggtttgcatctcagcaaccgaaccaaaccaaaccgcaagaataatgaatattacctaaacatgtactagcccaattacat 3682304  T
508 agctcaagaataatc 522  Q
    | |  ||||||||||    
3682303 aacctaagaataatc 3682289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 374 - 600
Target Start/End: Original strand, 36827341 - 36827582
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgca---------------accag 458  Q
    |||||||| || || |||||||| || |||||||||||||||  | |||||||||| ||||||||||||||||||| |||               ||||     
36827341 cgcacttggttcggctgaattcgaatgacttttgcactgaaccacacggtttggttcggtttgcggtttgcatctcagcagccgaaccaaaccaaaccaa 36827440  T
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaa 558  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||                  |||||||||| ||||||     
36827441 accgcaagaataatgaatattacttaaacatgtactagcccaattacatagctcaagattaatctctttcgattcaatttttccattgttgcaccatcag 36827540  T
559 gttcgattctaattcttttccatctctttcgattcatttcca 600  Q
    ||||||||||||||  |||||||||||||| ||| |||||||    
36827541 gttcgattctaatttctttccatctctttcaatttatttcca 36827582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 377 - 508
Target Start/End: Complemental strand, 44673255 - 44673109
Alignment:
377 acttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc---------------aaccagacc 461  Q
    ||||| || |||||||||||||| ||||||||||||||| |||||||| |||||||||||||||||||||||| ||               ||||| ||     
44673255 acttggttcggatgaattcggatgacttttgcactgaaccgcgcggttcggtttggtttgcggtttgcatctcagcaaccgaaccaaaccaaaccaaact 44673156  T
462 gcaagaataatgaatattacttaaacatgtactagtccaattacata 508  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||    
44673155 gcaagaataatgaatattacttaaacatgtactagcccaattacata 44673109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 373 - 522
Target Start/End: Complemental strand, 30392614 - 30392450
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------a 457  Q
    ||||||||| ||||||||||||||||| ||||||  ||||||| |||||||||||||  |||||||||||| |||||  |||||               |    
30392614 ccgcacttggtttggatgaattcggatgacttttttactgaaccgcgcggtttggttcagtttgcggtttgtatctcaacaaccgaaccaaaccaaacca 30392515  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
     |||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||||||    
30392514 aaccgcaagaataatgaatattacttaaacatgtactagcccaattacatagcccaacaataatc 30392450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 453 - 522
Target Start/End: Original strand, 6200579 - 6200648
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| |||||||||||||||||||||||| ||||||||||||| ||||||||||| | |||||||||||    
6200579 aaccaaaccgcaagaataatgaatattactgaaacatgtactagcccaattacataacccaagaataatc 6200648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 453 - 518
Target Start/End: Complemental strand, 10661588 - 10661523
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaat 518  Q
    ||||| |||||||| |||||||||||  |||||||||||||||| || ||||||||||||||||||    
10661588 aaccaaaccgcaaggataatgaatatatcttaaacatgtactagcccgattacatagctcaagaat 10661523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 373 - 457
Target Start/End: Original strand, 5802504 - 5802588
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacca 457  Q
    ||||||||| || |||||| ||| ||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| |||||||    
5802504 ccgcacttggttcggatgagttcagatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacca 5802588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 542 - 604
Target Start/End: Complemental strand, 10661499 - 10661437
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtga 604  Q
    ||||||||  |||||| ||||||||||||||| |||||| ||||||| |||||||||||||||    
10661499 cattgttgtaccatcatgttcgattctaattcatttccaactctttcaattcatttccagtga 10661437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 401 - 449
Target Start/End: Original strand, 36909924 - 36909972
Alignment:
401 acttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||||| |||||||||||||| |||| |||||||||||||||||||    
36909924 acttttgcattgaactgcgcggttcggttcggtttgcggtttgcatctc 36909972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 541 - 597
Target Start/End: Original strand, 36910063 - 36910119
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcattt 597  Q
    |||||||||| |||||| ||| ||||||||||| |||||||||||||| ||||||||    
36910063 ccattgttgcaccatcaggtttgattctaattcatttccatctctttcaattcattt 36910119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 373 - 431
Target Start/End: Complemental strand, 33069122 - 33069064
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttg 431  Q
    ||||||||| ||||||||| ||||||| |||||||||||||||  ||||||||| ||||    
33069122 ccgcacttggtttggatgatttcggatgacttttgcactgaaccacgcggtttgatttg 33069064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 453 - 522
Target Start/End: Complemental strand, 33069032 - 33068963
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| ||| ||| |||||| |||||||||||||  ||||| || ||||||||||| |||||||||||||    
33069032 aaccaaaccacaaaaataatcaatattacttaaatttgtaccagcccaattacataactcaagaataatc 33068963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 401 - 449
Target Start/End: Complemental strand, 10661654 - 10661607
Alignment:
401 acttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    |||||||||||||||  |||||||||||||||||||| |||||||||||    
10661654 acttttgcactgaaccacgcggtttggtttggtttgc-gtttgcatctc 10661607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 605
Target Start/End: Complemental strand, 14549580 - 14549516
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||  |||||| ||||||||||| ||| |||||||||||||| ||| |||| |||||||    
14549580 ccattgttgtaccatcaggttcgattctatttcctttccatctctttcaattaattttcagtgat 14549516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 605
Target Start/End: Complemental strand, 33068944 - 33068880
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||| ||||||| |||||||||||||| ||| ||| || ||| |||||||| |||||||    
33068944 ccattgttgcaccatcaaattcgattctaattccttttcatttccttcaattcattttcagtgat 33068880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 324 - 448
Target Start/End: Original strand, 6200436 - 6200559
Alignment:
324 aatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggt 423  Q
    |||||||||| | ||||||||||||| |||||| |||||||        | ||| ||| || |||||||||||||| ||||||||||||||  | |||||    
6200436 aatagaaaaacctcaaatcaaatcaatccaaatcgaaaccg-caaaaaactgcatttggttcggatgaattcggatgacttttgcactgaatcgtgcggt 6200534  T
424 ttggtttggtttgcggtttgcatct 448  Q
    || ||| |||||  |||||||||||    
6200535 ttcgttcggtttttggtttgcatct 6200559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 563 - 605
Target Start/End: Complemental strand, 30392409 - 30392367
Alignment:
563 gattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||| |||||||||||||  ||||||||||||||||    
30392409 gattctaattcctttccatctcttttaattcatttccagtgat 30392367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 81; Significance: 8e-38; HSPs: 21)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 318 - 605
Target Start/End: Original strand, 25297750 - 25298051
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||||||||||  ||| ||| ||||| |||||||||       |||||||||||| |||||||||||||| ||||||||  ||||| |    
25297750 caacccaatagaaaaatcgcaaactaaaccaatccaaactgaaaccgtaaaaaa-ccgcacttgattcggatgaattcggatgacttttgctttgaaccg 25297848  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaacc---------------agaccgcaagaataatgaatattacttaaacatgtactagtccaat 502  Q
    | ||||| ||||||||||| |||||||||||| ||||||               | |||||||||||||||||||||||||||||||||||||| |||||    
25297849 cacggttcggtttggtttgtggtttgcatctcagcaaccgaaccaaaccaaaccaaaccgcaagaataatgaatattacttaaacatgtactagcccaat 25297948  T
503 tacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagt 602  Q
    ||||||||||||||||||||                  |||||||||| |||||| ||||||||||||||  |||||||||||||| ||| |||||||||    
25297949 tacatagctcaagaataatcgcttttgattcgatttttccattgttgcaccatcaggttcgattctaatttctttccatctctttcaatttatttccagt 25298048  T
603 gat 605  Q
    |||    
25298049 gat 25298051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 373 - 605
Target Start/End: Complemental strand, 11376416 - 11376174
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaac----------cagaccg 462  Q
    ||||||||| || |||||||||| ||| ||||||||||||||| |||||||| |||| ||||||| ||||||||||| |||||          || ||||    
11376416 ccgcacttggttcggatgaattcagatgacttttgcactgaaccgcgcggttcggttcggtttgcagtttgcatctcagcaactgaaccaaaccaaaccg 11376317  T
463 caagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttc 562  Q
    |||||||| |||||||||||||||||||||||||  ||||| |||||| |||||||||||                  |||||||||| |||||| ||||    
11376316 caagaatactgaatattacttaaacatgtactagctcaattgcatagcccaagaataatcgcttttgattcgatttttccattgttgcaccatcaggttc 11376217  T
563 gattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||| |||||||||||||| ||||||||||||||||    
11376216 gattctaattcctttccatctctttcaattcatttccagtgat 11376174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 373 - 605
Target Start/End: Original strand, 44979323 - 44979570
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc---------------aacca 457  Q
    ||||||||| || |||||||||||||| | ||||||||||||| |||||||||| |||||||||||||||||||||| ||               |||||    
44979323 ccgcacttggttcggatgaattcggatgaattttgcactgaaccgcgcggtttgatttggtttgcggtttgcatctcagctaccgaaccaaaccaaacca 44979422  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatca 557  Q
     |||||||||||||||||| ||||||||||||||||||| ||||||||||||| || ||||||||                  |||||||||| |||| |    
44979423 aaccgcaagaataatgaatgttacttaaacatgtactagcccaattacatagcccaggaataatctcttttgattcgatttttccattgttgcaccatga 44979522  T
558 agttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
     |||| |||||||||| |||||||||||||  ||||||||||||||||    
44979523 ggttcaattctaattcctttccatctcttttaattcatttccagtgat 44979570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 453 - 522
Target Start/End: Original strand, 17916501 - 17916570
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
17916501 aaccaaaccgcaagaataatgaatattacttaaacatgtactagcccaattacatagctcaagaataatc 17916570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 373 - 521
Target Start/End: Original strand, 19936673 - 19936831
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagacc----------g 462  Q
    ||||||||| || |||||||||| |||  ||||| ||||||||||||||||| |||| ||||||| ||||| ||||| ||||||| |||          |    
19936673 ccgcacttggttcggatgaattcagatgtctttttcactgaactgcgcggttcggttcggtttgcagtttgtatctcagcaaccaaaccaaaccaaaccg 19936772  T
463 caagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
    |||||||||||||||||||||| |||||||||||  ||| |||||||||||||||||||    
19936773 caagaataatgaatattacttatacatgtactagctcaaatacatagctcaagaataat 19936831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 393 - 605
Target Start/End: Complemental strand, 44035824 - 44035597
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------agaccgcaagaataatgaata 477  Q
    ||||||| ||||||||||||||| |||||||| |||||||||| ||||||||||||| ||||||               | ||||||| |||||||||||    
44035824 ttcggatgacttttgcactgaaccgcgcggttcggtttggtttacggtttgcatctcagcaaccgaaccaaaccaaaccaaaccgcaaaaataatgaata 44035725  T
478 ttacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattctttt 577  Q
    |||||||||||||||||||  || ||||||| |||||||||||||                   ||||||||| | |||||||||||||||||||| |||    
44035724 ttacttaaacatgtactagctcagttacataactcaagaataatctcttttgattcgattttttcattgttgcacgatcaagttcgattctaattccttt 44035625  T
578 ccatctctttcgattcatttccagtgat 605  Q
    ||||||||||| ||||||||||||||||    
44035624 ccatctctttcaattcatttccagtgat 44035597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 453 - 521
Target Start/End: Complemental strand, 34910749 - 34910681
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
    ||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||| ||||||||||    
34910749 aaccaaaccgcaagaataatgaatattacttaaacatgtactaacccaattacatagcccaagaataat 34910681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 9811851 - 9811768
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
9811851 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 9811768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 318 - 454
Target Start/End: Complemental strand, 20420943 - 20420808
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||| | || ||||||||| ||||||||        ||||||||| || |||||| ||||||| ||||||  ||||||| |    
20420943 caacccaatagaaaaaccgcaaaccgaaccaacccaaactgaaaccg-caaaaaaccgcacttggttcggatgagttcggatgacttttagactgaaccg 20420845  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaa 454  Q
    ||||||| |||| ||||||||||||||||||| ||||    
20420844 cgcggttcggttcggtttgcggtttgcatctcagcaa 20420808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 374 - 455
Target Start/End: Complemental strand, 16579100 - 16579019
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaac 455  Q
    |||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| |||||    
16579100 cgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaac 16579019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 453 - 510
Target Start/End: Complemental strand, 18360240 - 18360183
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagc 510  Q
    ||||| |||||||||||||| |||||||||||||| |||||||| |||||||||||||    
18360240 aaccaaaccgcaagaataatcaatattacttaaacttgtactagcccaattacatagc 18360183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 318 - 454
Target Start/End: Original strand, 36412855 - 36412990
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||||| || |||||||||  |||||||        ||||||||| || |||||| ||||||| ||||||  ||||||| |    
36412855 caacccaatagaaaaaccgcaaatcgaaccaacccaaaccgaaaccg-caaaaaaccgcacttggttcggatgagttcggatgacttttagactgaaccg 36412953  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaa 454  Q
     |||||| |||| ||||||||||||||||||| ||||    
36412954 tgcggttcggttcggtttgcggtttgcatctcagcaa 36412990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 542 - 603
Target Start/End: Original strand, 19936852 - 19936913
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtg 603  Q
    ||||||||| |||||| ||||||||||||||  |||||||||| ||| ||||||||||||||    
19936852 cattgttgcaccatcatgttcgattctaatttctttccatctcattcaattcatttccagtg 19936913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 393 - 449
Target Start/End: Original strand, 42785098 - 42785154
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||| ||||||||| |||||  ||||||| ||||||||||||||||||||||||    
42785098 ttcggatgacttttgcattgaaccacgcggttcggtttggtttgcggtttgcatctc 42785154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 559 - 605
Target Start/End: Original strand, 17916609 - 17916655
Alignment:
559 gttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||| |||||| |||||||||||||| ||||||||||||||||    
17916609 gttcgattataattcctttccatctctttcaattcatttccagtgat 17916655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 373 - 449
Target Start/End: Complemental strand, 18360335 - 18360259
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||||| || |||| |||||| || ||||||||| |||||  ||||||| |||||||||| | |||||||||||    
18360335 ccgcacttggttcggataaattcgaatgacttttgcattgaaccacgcggttcggtttggtttacagtttgcatctc 18360259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 605
Target Start/End: Complemental strand, 20420551 - 20420487
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||  ||||| ||| ||||||||||| |||||||||| ||| ||||||||||| ||||    
20420551 ccattgttgcatcatcaggtttgattctaattcctttccatctccttcaattcatttccaatgat 20420487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 34910661 - 34910605
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcattt 597  Q
    |||||||||| |||||||||||||||||||||| ||| ||| ||| || ||||||||    
34910661 ccattgttgcaccatcaagttcgattctaattcgttttcatttctctcaattcattt 34910605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 449
Target Start/End: Original strand, 17916412 - 17916482
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    |||||||||||| ||||||||||| || |||||| |      |||||||||| ||||||||||| ||||||||||||    
17916412 ccgcacttgattcggatgaattcgaatgactttttc------ctgcgcggttcggtttggtttgtggtttgcatctc 17916482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 442
Target Start/End: Original strand, 27301011 - 27301080
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggttt 442  Q
    ||||| |||||||||||| |||||||| ||||||   || ||| ||  ||||||||||||||||||||||    
27301011 ccgcatttgatttggatgtattcggatcacttttttcctcaaccgcatggtttggtttggtttgcggttt 27301080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 323 - 363
Target Start/End: Complemental strand, 12841958 - 12841918
Alignment:
323 caatagaaaaatcgcaaatcaaatcaacccaaattgaaacc 363  Q
    ||||||||||| |||||||| |||||| |||||||||||||    
12841958 caatagaaaaaccgcaaatcgaatcaatccaaattgaaacc 12841918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 78; Significance: 5e-36; HSPs: 35)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 322 - 605
Target Start/End: Original strand, 12680573 - 12680870
Alignment:
322 tcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactgcgcg 421  Q
    |||||||||||| ||||||||||| ||| ||||| ||||||||        ||||||||| ||  ||||||||||||| ||||||||| ||||| |||||    
12680573 tcaatagaaaaaccgcaaatcaaaccaatccaaactgaaaccg-caaaaaaccgcacttggttcagatgaattcggatgacttttgcaatgaaccgcgcg 12680671  T
422 gtttggtttggtttgcggtttgcatctctgc---------------aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattaca 506  Q
    |||||||||||||||||||||||||||| ||               ||||| ||||||||||| |||||||||||||||||||||||||| |||||||||    
12680672 gtttggtttggtttgcggtttgcatctcagcaaccgaaccaaaccaaaccaaaccgcaagaatgatgaatattacttaaacatgtactagcccaattaca 12680771  T
507 tagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    || || || |||||||                  |||||||||| |||||| ||||||||||||||| |||||||||||||| ||||||||| ||||||    
12680772 taacttaaaaataatctcttttgattcgatttttccattgttgcaccatcaggttcgattctaattcctttccatctctttcaattcatttcaagtgat 12680870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 323 - 605
Target Start/End: Original strand, 2226382 - 2226678
Alignment:
323 caatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactgcgcgg 422  Q
    |||||||||||||| ||||||||| ||  ||||| |||||||        ||||||||| || |||||||||||||| ||||||||||| ||| ||||||    
2226382 caatagaaaaatcgtaaatcaaattaattcaaatcgaaaccg-caaaaaaccgcacttggttcggatgaattcggatgacttttgcacttaaccgcgcgg 2226480  T
423 tttggtttggtttgcggtttgcatctctgcaacc---------------agaccgcaagaataatgaatattacttaaacatgtactagtccaattacat 507  Q
    ||  ||| ||||||||||||||||||| ||||||               | ||||| |||||||||||||||||||||||||||| ||| ||||||||||    
2226481 ttcagttcggtttgcggtttgcatctcagcaaccgaaccaaaccaaaccaaaccgccagaataatgaatattacttaaacatgtattagcccaattacat 2226580  T
508 agctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||| ||||||||                  |||||||||| |||||| ||||||||||||||| |||||||||||||| |||||||||| |||||    
2226581 agctcatgaataatctcttttgattcgatttttccattgttgcaccatcaggttcgattctaattcctttccatctctttcaattcatttcctgtgat 2226678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 376 - 605
Target Start/End: Original strand, 36103162 - 36103406
Alignment:
376 cacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------agac 460  Q
    |||||| || |||||||||| ||| ||||||||||||||| |||||||| | |||||||||  ||||||||||| ||||||               | ||    
36103162 cacttggttcggatgaattcagatgacttttgcactgaaccgcgcggttcgttttggtttgtagtttgcatctcagcaaccgaaccaaaccaaaccaaac 36103261  T
461 cgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagt 560  Q
    ||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||                  |||||||||| |||||||||    
36103262 cgcaagaataatgaatattacttgaacatgtactagcccaactacatagctcaagaataatcgtttttgattcgatttttccattgttgcaccatcaagt 36103361  T
561 tcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||||| |||||||||||||| |||||||| |||||||    
36103362 tcgattctaattcctttccatctctttcaattcatttacagtgat 36103406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 373 - 605
Target Start/End: Original strand, 12165491 - 12165738
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaac---------------ca 457  Q
    ||||||||| || |||||||||||||| ||||||||||||||| ||  |||| |||| ||||||| ||||||||||| |||||               ||    
12165491 ccgcacttggttcggatgaattcggatgacttttgcactgaaccgcatggttcggttcggtttgcagtttgcatctcagcaactgaaccaaacgaaacca 12165590  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatca 557  Q
     |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||                  |||||||||| ||||||    
12165591 aaccgcaagaataatgaatattacttaaacatgtactagcccaattacatagctcaagaataatctctttcgattcgatctttccattgttgcaccatca 12165690  T
558 agttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
     |||| ||| |||||| ||| |||||||||||||| ||||||||||||    
12165691 ggttcaattttaattccttttcatctctttcgatttatttccagtgat 12165738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 373 - 605
Target Start/End: Original strand, 32520773 - 32521015
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc----------aaccagaccg 462  Q
    ||||||||| || |||||||||||||| ||||||||| ||||| |||||||| ||||||||||||| | |||||||| ||          ||||| ||||    
32520773 ccgcacttggttcggatgaattcggatgacttttgcaatgaaccgcgcggttcggtttggtttgcgatctgcatctcagcaaccgaaccaaaccaaaccg 32520872  T
463 caagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttc 562  Q
    ||||||| |||||||||||||||| ||||||||| |||||||||||  | ||||||||||                   ||||||||| |||||| ||||    
32520873 caagaatgatgaatattacttaaagatgtactagcccaattacataatttaagaataatctcttttgattcgattttttcattgttgcaccatcaggttc 32520972  T
563 gattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||| ||| |||||||||||||| ||||||||| ||||||    
32520973 gattctagttcatttccatctctttcaattcatttcaagtgat 32521015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 461 - 605
Target Start/End: Original strand, 30265444 - 30265587
Alignment:
461 cgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagt 560  Q
    ||||||||||||||||||||||||| ||||| |||| ||||||||||||||||| ||||| |                  |||||||||| |||||||||    
30265444 cgcaagaataatgaatattacttaatcatgtgctagcccaattacatagctcaaaaataa-cgctttcaattcgatttttccattgttgcaccatcaagt 30265542  T
561 tcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||||| ||||||||||||||| ||||||||||||||||    
30265543 tcgattctaattattttccatctctttcaattcatttccagtgat 30265587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 10174589 - 10174507
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    |||||||||||| |||||||||||||| ||||||||||||||| ||||||||| ||| | ||||||||||||||||| ||||||    
10174589 ccgcacttgattcggatgaattcggatgacttttgcactgaaccgcgcggttt-gttcgatttgcggtttgcatctcagcaacc 10174507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 373 - 522
Target Start/End: Original strand, 36176668 - 36176832
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------a 457  Q
    ||||||||| || | |||||||||||| ||||||||||| ||| ||  |||| || ||||||||||||||||||||| ||||||               |    
36176668 ccgcacttggttcgaatgaattcggatgacttttgcactaaaccgcatggttcgggttggtttgcggtttgcatctcagcaaccgaaccaaatcaaacca 36176767  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
     |||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||| ||||    
36176768 aaccgcaagaataatgactattacttaaacgtgtactagcccaattacatagctcaagaaaaatc 36176832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 453 - 522
Target Start/End: Original strand, 36176532 - 36176601
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| |||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||| ||||    
36176532 aaccaaaccgcaagaataatgactattacttaaacgtgtactagcccaattacatagctcaagaaaaatc 36176601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 459 - 605
Target Start/End: Original strand, 332930 - 333078
Alignment:
459 accgcaagaataatgaatattacttaaacatgtactagtccaattac--atagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatc 556  Q
    |||||||||||||||||||||||||||||||||||| | ||||||||  |||||||||||||||||                  ||||  |||| |||||    
332930 accgcaagaataatgaatattacttaaacatgtactggcccaattacatatagctcaagaataatctattttgattcgatttttccataattgcaccatc 333029  T
557 aagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||||||||| |||| ||||||||| |||||||||| |||||    
333030 aagttcgattctaattcctttctatctctttcaattcatttcccgtgat 333078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 318 - 456
Target Start/End: Original strand, 38334309 - 38334446
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||| | || |||||||||| |||||||        ||||||||| || |||||| ||||||| ||||||  ||||||| |    
38334309 caacccaatagaaaaaccgcaaaccgaaccaacccaaatcgaaaccg-caaaaaaccgcacttggttcggatgagttcggatgacttttagactgaaccg 38334407  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| |||| ||||||||||||||||||| ||||||    
38334408 cgcggttcggttcggtttgcggtttgcatctcagcaacc 38334446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 323 - 456
Target Start/End: Original strand, 666831 - 666963
Alignment:
323 caatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactgcgcgg 422  Q
    ||||||||||| |||||| | || ||||||||| ||||||||        ||||||||| || |||||| ||||||| ||||||  ||||||| ||||||    
666831 caatagaaaaaccgcaaaccgaaccaacccaaactgaaaccg-caaaaaaccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcgg 666929  T
423 tttggtttggtttgcggtttgcatctctgcaacc 456  Q
    || |||| ||||||||||||||||||| ||||||    
666930 ttcggttcggtttgcggtttgcatctcagcaacc 666963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 541 - 605
Target Start/End: Complemental strand, 9161334 - 9161270
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||| ||||||||||| |||||||||| |||||||||||||  ||||||||||||||||    
9161334 ccattgttgcaccatcaagttcaattctaattcctttccatctctttgaattcatttccagtgat 9161270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 474 - 522
Target Start/End: Complemental strand, 35893405 - 35893357
Alignment:
474 aatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||||||||||||||||||||| |||||||||||||||||||||||||    
35893405 aatattacttaaacatgtactagcccaattacatagctcaagaataatc 35893357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 462 - 522
Target Start/End: Complemental strand, 42545086 - 42545026
Alignment:
462 gcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||||||||||||||||||||||| ||||| ||| ||||| |||||||||||||||||||    
42545086 gcaagaataatgaatattacttaaatatgtaatagcccaataacatagctcaagaataatc 42545026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 11917916 - 11917833
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| ||||||||| ||||||| ||||||  ||| ||| |||||||| |||| ||||||||||||||||||| ||||||    
11917916 ccgcacttggtttggatgagttcggatgacttttagactaaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 11917833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 27885695 - 27885778
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
27885695 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 27885778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 318 - 449
Target Start/End: Complemental strand, 15068991 - 15068861
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||| | || |||||||||| |||||||        ||||||||| || |||||| ||||||| ||||||  ||||||| |    
15068991 caacccaatagaaaaaccgcaaaccgaaccaacccaaatcgaaaccg-caaaaaaccgcacttggttcggatgagttcggatgacttttagactgaaccg 15068893  T
418 cgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||| |||| |||||||||||||||||||    
15068892 cgcggttcggttcggtttgcggtttgcatctc 15068861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 374 - 605
Target Start/End: Complemental strand, 38434219 - 38433973
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc---------------aaccag 458  Q
    |||||||| ||| |||||||| |||| ||||||||||||||| | | |||| |||||| ||||||||||| ||||| ||               |||||     
38434219 cgcacttggtttagatgaatttggatgacttttgcactgaaccgtgaggttcggtttgatttgcggtttgtatctcagcaaccgaaccaaaccaaaccaa 38434120  T
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaa 558  Q
    |||||||||||||  |||||||||||||| |||||||| |||||||||||||  ||||||||||                  |||||||||| ||||||     
38434119 accgcaagaataagaaatattacttaaacttgtactagcccaattacatagcctaagaataatctcttttaattcgatttttccattgttgcaccatcac 38434020  T
559 gttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||||||||||| |||||| ||  ||||||||||| ||||    
38434019 gttcgattctaattctttttcatctcctttaattcatttccaatgat 38433973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 375 - 449
Target Start/End: Complemental strand, 42545914 - 42545840
Alignment:
375 gcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||| || |||||||||| ||| ||||||||||| ||| |||||||| |||| |||||||||||||||||||    
42545914 gcacttggttcggatgaattcagatgacttttgcactaaaccgcgcggttcggttcggtttgcggtttgcatctc 42545840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 318 - 456
Target Start/End: Complemental strand, 9161570 - 9161432
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| |||||||||||  ||||| |||| ||| ||||| ||||||||        ||| ||||| || |||||||||| ||| ||||||||||||||| |    
9161570 caacccaatagaaaaactgcaaaccaaaccaatccaaactgaaaccgcaaaaaaaccgtacttggttcggatgaattcagatgacttttgcactgaaccg 9161471  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
     |||||| |||| ||||||||||||| ||||| ||||||    
9161470 tgcggttcggttcggtttgcggtttgaatctcagcaacc 9161432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 545 - 605
Target Start/End: Original strand, 36176835 - 36176895
Alignment:
545 tgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||| |||||| |||| |||||||||| |||||||||||||||||||||||||| ||||    
36176835 tgttgcaccatcaggttcaattctaattcctttccatctctttcgattcatttccaatgat 36176895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 8409447 - 8409364
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||  |||||||| |||| ||||||||||||||||||| ||||||    
8409447 ccgcacttggttcggatgagttcggatgacttttagactgaatcgcgcggttcggttcggtttgcggtttgcatctcagcaacc 8409364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 375 - 508
Target Start/End: Original strand, 17084436 - 17084573
Alignment:
375 gcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc-----agaccgcaagaat 469  Q
    |||||||||| |||||||||| ||| ||| ||||| ||||| ||||  || |||| | ||| | ||||||||||| ||||||     | |||||||||||    
17084436 gcacttgattcggatgaattcagatgactgttgcattgaaccgcgca-ttcggttcgatttccagtttgcatctcagcaaccgaaccaaaccgcaagaat 17084534  T
470 aatgaatattacttaaacatgtactagtccaattacata 508  Q
    ||| |||||||||||||| |||||||  |||||||||||    
17084535 aatcaatattacttaaacttgtactaacccaattacata 17084573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 318 - 456
Target Start/End: Complemental strand, 30002513 - 30002376
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||| | || ||||||||| ||||||||        ||||||||| || |||||| ||||||| | ||||  ||||||| |    
30002513 caacccaatagaaaaaccgcaaaccgaaccaacccaaactgaaaccg-caaaaaaccgcacttggttcggatgagttcggatgatttttagactgaaccg 30002415  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| |||| |||||||||||| |||||| ||||||    
30002414 cgcggttcggttcggtttgcggtttacatctcagcaacc 30002376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 401 - 449
Target Start/End: Original strand, 332857 - 332905
Alignment:
401 acttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||||||||||| |||| ||| ||||||||||||||||||||||||    
332857 acttttgcactgaaccgcgcagttcggtttggtttgcggtttgcatctc 332905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 470 - 518
Target Start/End: Complemental strand, 10174482 - 10174434
Alignment:
470 aatgaatattacttaaacatgtactagtccaattacatagctcaagaat 518  Q
    ||||||||||||||||||||||||||  ||||||||||| |||||||||    
10174482 aatgaatattacttaaacatgtactatcccaattacataactcaagaat 10174434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 542 - 605
Target Start/End: Complemental strand, 35893337 - 35893273
Alignment:
542 cattgttgctccatcaagttcgattctaattc-ttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||| |||||| | ||||||||||||| |||||||||| |||| ||||||||||||||||    
35893337 cattgttgcaccatcacgctcgattctaattccttttccatctttttcaattcatttccagtgat 35893273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 541 - 605
Target Start/End: Original strand, 38334695 - 38334759
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||  ||||| ||||||||||||||| |||||||||| ||| ||||||||||| ||||    
38334695 ccattgttgcatcatcaggttcgattctaattcctttccatctccttcaattcatttccaatgat 38334759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 374 - 449
Target Start/End: Original strand, 36176438 - 36176513
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    |||||||| || | |||||||||||| ||||||||||| ||| ||  |||| || |||||||||||||||||||||    
36176438 cgcacttggttcgaatgaattcggatgacttttgcactaaaccgcatggttcgggttggtttgcggtttgcatctc 36176513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 541 - 599
Target Start/End: Complemental strand, 23781080 - 23781022
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttcc 599  Q
    |||||||||  |||||  ||||||||||||||| |||||||||||||| ||||||||||    
23781080 ccattgttgtaccatcgggttcgattctaattcctttccatctctttcaattcatttcc 23781022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 541 - 599
Target Start/End: Complemental strand, 23868033 - 23867975
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttcc 599  Q
    |||||||||  |||||  ||||||||||||||| |||||||||||||| ||||||||||    
23868033 ccattgttgtaccatcgggttcgattctaattcctttccatctctttcaattcatttcc 23867975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 373 - 437
Target Start/End: Complemental strand, 23781239 - 23781175
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgc 437  Q
    |||||||||  | |||||| ||| ||| |||||||||||||||||||||||| |||| |||||||    
23781239 ccgcacttggatcggatgatttcagatgacttttgcactgaactgcgcggttcggttcggtttgc 23781175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 373 - 437
Target Start/End: Complemental strand, 23868192 - 23868128
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgc 437  Q
    |||||||||  | |||||| ||| ||| |||||||||||||||||||||||| |||| |||||||    
23868192 ccgcacttggatcggatgatttcagatgacttttgcactgaactgcgcggttcggttcggtttgc 23868128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 701678 - 701595
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| || |||| ||||||  ||| ||| || ||||| |||| ||||||||||||||||||| ||||||    
701678 ccgcacttggttcggatgagtttggatgacttttagactaaaccgcacggttcggttcggtttgcggtttgcatctcagcaacc 701595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0059 (Bit Score: 74; Significance: 1e-33; HSPs: 2)
Name: scaffold0059
Description:

Target: scaffold0059; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 383 - 605
Target Start/End: Original strand, 69093 - 69330
Alignment:
383 tttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaac---------------cagaccgcaaga 467  Q
    ||||||||||||||||| ||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||               ||  ||||||||    
69093 tttggatgaattcggatgacttttgcaatgaaccgcgcggttcggtttggtttgcggtttgcatctcagcaaccgaaccaaaccaaaacaacccgcaaga 69192  T
468 ataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattc 567  Q
    ||||||||||||||||||||||||||||| | ||||||||||| ||| |||||||                  |||||||||| ||||||| ||||||||    
69193 ataatgaatattacttaaacatgtactagcctaattacatagcccaataataatctcttttgattcgatttttccattgttgcaccatcaaattcgattc 69292  T
568 taattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||| |||||||||||||| ||||||||||||||||    
69293 taattcctttccatctctttcaattcatttccagtgat 69330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0059; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 383 - 522
Target Start/End: Original strand, 77199 - 77353
Alignment:
383 tttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaac---------------cagaccgcaaga 467  Q
    ||||||||||||||||| ||||||||| ||||| |||||||| |||||||||||||||||||||||| |||||               ||  ||||||||    
77199 tttggatgaattcggatgacttttgcaatgaaccgcgcggttcggtttggtttgcggtttgcatctcagcaaccgaaccaaaccaaaacaacccgcaaga 77298  T
468 ataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||||||||||||||||||||||||||| | ||||||||||| ||| |||||||    
77299 ataatgaatattacttaaacatgtactagcctaattacatagcccaataataatc 77353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 73; Significance: 5e-33; HSPs: 18)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 376 - 605
Target Start/End: Original strand, 6003944 - 6004188
Alignment:
376 cacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc---------------aaccagac 460  Q
    |||||| || |||||||||||||| ||||||||||||||| ||| ||||||||| ||||||||||||||||||| ||               ||||| ||    
6003944 cacttggttcggatgaattcggatgacttttgcactgaaccgcgaggtttggttcggtttgcggtttgcatctcagctaccgaaccaaaccaaaccaaac 6004043  T
461 cgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagt 560  Q
    |||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||                  |||||||||| |||||| ||    
6004044 cgcaagaataatgaatgttacttaaacatgtactagcccaattacatagcccaagaataatctcttttgattcgatttttccattgttgcaccatcaggt 6004143  T
561 tcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    || |||||||||| |||||||||||||  ||||||||||||||||    
6004144 tcaattctaattcctttccatctcttttaattcatttccagtgat 6004188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 393 - 600
Target Start/End: Complemental strand, 32880816 - 32880599
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc----------agaccgcaagaataatgaatattact 482  Q
    ||||||| ||||||||||||||| |||| ||| |||||||||| ||||||||||||| ||||||          | |||||||||| |||||||||||||    
32880816 ttcggatgacttttgcactgaaccgcgcagttcggtttggtttacggtttgcatctcagcaaccgaaccaaaccaaaccgcaagaaaaatgaatattact 32880717  T
483 taaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccatc 582  Q
    |||||||||||||||||||||||||||||||||  |||||                  |||||||||| |||||| ||| ||||||||||| ||||||||    
32880716 taaacatgtactagtccaattacatagctcaagtttaatctctttcgatttgatttttccattgttgcaccatcaggtttgattctaattcctttccatc 32880617  T
583 tctttcgattcatttcca 600  Q
    |||||| |||||||||||    
32880616 tctttcaattcatttcca 32880599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 375 - 599
Target Start/End: Original strand, 35531712 - 35531946
Alignment:
375 gcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc----------agaccgca 464  Q
    ||||||| || |||||||||| | | ||||||||||||||| || |||||  ||| | ||||| ||||||||||| ||||||          | ||||||    
35531712 gcacttggttcggatgaattcaggtgacttttgcactgaaccgcacggttcagttcgatttgcagtttgcatctcagcaaccgaaccaaaccaaaccgca 35531811  T
465 agaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcga 564  Q
    |||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||                  |||||||||| |||||| ||||||    
35531812 agaataatgaatattacttaaacatgtactagcccaattgcatagctcaagaataatcgttttttattcgatttttccattgttgcaccatcatgttcga 35531911  T
565 ttctaattcttttccatctctttcgattcatttcc 599  Q
    ||||||||| |||||||||||||| ||||||||||    
35531912 ttctaattcctttccatctctttcaattcatttcc 35531946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 453 - 605
Target Start/End: Original strand, 50562224 - 50562376
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctc 552  Q
    ||||| ||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||                  |||||||||| |    
50562224 aaccaaaccccaagaataatgaatattacttaaacatgtactagcccaattacatagctcaagaataatctctttcgattcgatttttccattgttgcac 50562323  T
553 catcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||| ||||||||||||||| |||||||||||||| ||| |||| |||||||    
50562324 catcaggttcgattctaattcctttccatctctttcaatttattttcagtgat 50562376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 433 - 522
Target Start/End: Complemental strand, 39098398 - 39098309
Alignment:
433 tttgcggtttgcatctctgcaaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    |||| |||||||||||| ||||||  |||||||||||||||||||||||||||||||||||||   |||||| |||||||||||||||||    
39098398 tttgtggtttgcatctcagcaaccgaaccgcaagaataatgaatattacttaaacatgtactaacacaattaaatagctcaagaataatc 39098309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 373 - 505
Target Start/End: Original strand, 48032689 - 48032836
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgc---------------aacca 457  Q
    ||||||||| ||  ||||||||||||| ||||||||| ||||| |||||||| |||||||||||||||||||||||| ||               |||||    
48032689 ccgcacttggttcagatgaattcggatgacttttgcaatgaaccgcgcggttcggtttggtttgcggtttgcatctcagcagccgaaccaaaccaaacca 48032788  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattac 505  Q
     ||||||||||| |||||||||||||||||||||||||| ||||||||    
48032789 aaccgcaagaatcatgaatattacttaaacatgtactagcccaattac 48032836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 452 - 605
Target Start/End: Original strand, 21586488 - 21586641
Alignment:
452 caaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgct 551  Q
    |||||| | |||||||||||||||||||||||||||||||||||| | |||||||||| |||||||||||                   ||||||||||     
21586488 caaccaaatcgcaagaataatgaatattacttaaacatgtactagccaaattacatagttcaagaataatatctttcgattcgatttttccattgttgca 21586587  T
552 ccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||| | ||||||||||||||| |||||||||||||| |||||||||| |||||    
21586588 ccatgaggttcgattctaattcctttccatctctttcaattcatttccggtgat 21586641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 324 - 449
Target Start/End: Original strand, 27641722 - 27641846
Alignment:
324 aatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggt 423  Q
    |||||||||| |||||| |||| ||| |||||||||||| ||       ||||||||| || |||||||||| ||| ||||||||||||||| ||| |||    
27641722 aatagaaaaaccgcaaaccaaaccaatccaaattgaaactgtaaaaaa-ccgcacttggttcggatgaattcagatgacttttgcactgaaccgcgtggt 27641820  T
424 ttggtttggtttgcggtttgcatctc 449  Q
    ||| ||||||||||||||||||||||    
27641821 ttgatttggtttgcggtttgcatctc 27641846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 318 - 456
Target Start/End: Complemental strand, 10369776 - 10369639
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgtnnnnnnnccgcacttgatttggatgaattcggataacttttgcactgaactg 417  Q
    |||| ||||||||||| |||||| | || |||||||||| |||||||        ||||||||| || |||||||||||||| ||||||  ||||||| |    
10369776 caacccaatagaaaaaccgcaaaccgaaccaacccaaatcgaaaccg-caaaaaaccgcacttggttcggatgaattcggatgacttttagactgaaccg 10369678  T
418 cgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| |||| ||||||||||||||||||| ||||||    
10369677 cgcggttcggttcggtttgcggtttgcatctcagcaacc 10369639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 453 - 522
Target Start/End: Complemental strand, 33002957 - 33002888
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| ||||||||||||||||||||| |||||| |||||| |||||||||||||||||||| |||||||    
33002957 aaccaaaccgcaagaataatgaatatttcttaaatatgtaccagtccaattacatagctcaataataatc 33002888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 541 - 605
Target Start/End: Complemental strand, 43030778 - 43030714
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||| |||||||||||||||||||||| |||||||||||||| |||||| |||||||||    
43030778 ccattgttgcaccatcaagttcgattctaattcctttccatctctttcaattcatctccagtgat 43030714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 373 - 454
Target Start/End: Original strand, 35401782 - 35401863
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaa 454  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||    
35401782 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaa 35401863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 33361424 - 33361341
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| ||||||||| |||  |||||||||||||||||| ||||||    
33361424 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggtttagttcagtttgcggtttgcatctcagcaacc 33361341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 51149280 - 51149363
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||| ||||||||||||| ||||||    
51149280 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttacggtttgcatctcagcaacc 51149363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 541 - 604
Target Start/End: Complemental strand, 33002869 - 33002806
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtga 604  Q
    |||||||||| |||||| |||||||||||| || |||||||||||||| ||| |||||| ||||    
33002869 ccattgttgcaccatcaggttcgattctaactcctttccatctctttcaatttatttcctgtga 33002806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 605
Target Start/End: Original strand, 27641899 - 27641963
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||| || |||||| |||||| |||||||| | |||||||||||| |||||||| |||||||    
27641899 ccattgtagcaccatcaggttcgaatctaattcctctccatctctttcaattcattttcagtgat 27641963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 393 - 456
Target Start/End: Complemental strand, 34795015 - 34794952
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||| ||||||  ||||||| | |||||| |||| ||||||||||||||||||| ||||||    
34795015 ttcggatgacttttagactgaaccgtgcggttcggttcggtttgcggtttgcatctcagcaacc 34794952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 542 - 604
Target Start/End: Complemental strand, 39098289 - 39098227
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtga 604  Q
    ||||||||| |||||| | | ||||||||||  |||||||||||||| ||||||||| |||||    
39098289 cattgttgcaccatcaggattgattctaatttctttccatctctttcaattcatttcgagtga 39098227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 72; Significance: 2e-32; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 373 - 605
Target Start/End: Original strand, 35039486 - 35039733
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagacc----------- 461  Q
    ||||||||| || |||||||||||||| |||||||| |||||| ||||||||||||| |||||||||||||||||||  |||||| |||               
35039486 ccgcacttggttcggatgaattcggatgacttttgcgctgaaccgcgcggtttggttcggtttgcggtttgcatctcaacaaccaaaccaaaccaaacca 35039585  T
462 ----gcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatca 557  Q
        ||||||||||||||| ||||||||||||||||||| ||||||||||||| |||||||||||                  |||||||||| ||||||    
35039586 aaccgcaagaataatgaatgttacttaaacatgtactagcccaattacatagcccaagaataatctcttttgattcgatttttccattgttgcaccatca 35039685  T
558 agttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    | ||| |||||||||| |||||||||||||  ||||||||||||||||    
35039686 aattcaattctaattcctttccatctcttttaattcatttccagtgat 35039733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 401 - 605
Target Start/End: Complemental strand, 33550830 - 33550611
Alignment:
401 acttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------agaccgcaagaataatgaatattacttaa 485  Q
    ||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||               | |||||||||||||||||||||||||||    
33550830 acttttgcactgaaccgcgcggtttggttcggtttgcggtttgcatctcagcaaccgaaccgaaccaaaccaaaccgcaagaataatgaatattacttaa 33550731  T
486 acatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaagttcgattctaattcttttccatctct 585  Q
    ||||||||||| ||||||||||||| |||||||||||                  |||||||||| |||||| ||||||||||||||| |||| ||||||    
33550730 acatgtactagcccaattacatagcccaagaataatctcttttgattcgatttttccattgttgcaccatcaggttcgattctaattcctttcgatctct 33550631  T
586 ttcgattcatttccagtgat 605  Q
    ||  ||||||||| ||||||    
33550630 tttaattcatttctagtgat 33550611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 453 - 605
Target Start/End: Original strand, 13801620 - 13801772
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctc 552  Q
    ||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||                  |||||||||| |    
13801620 aaccaaaccgcaagaataatgaatattacttaaatatgtactagcccaattacatagctcaagaataatctcttttgattcaatttttccattgttgcac 13801719  T
553 catcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||| ||||||||||||||| ||| |||||||||| ||||||||||| ||||    
13801720 catcaggttcgattctaattccttttcatctctttcaattcatttccactgat 13801772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 459 - 521
Target Start/End: Complemental strand, 10591272 - 10591210
Alignment:
459 accgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
    |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||    
10591272 accgcaagaataatgaatattacttaaacatgtaatagcccaattacatagctcaagaataat 10591210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 453 - 522
Target Start/End: Complemental strand, 15860167 - 15860098
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    ||||| || ||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||    
15860167 aaccaaactgcaagaataatgaatattaattaaacatgtactagcccaattacatagctcaagaataatc 15860098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 376 - 522
Target Start/End: Complemental strand, 25137675 - 25137515
Alignment:
376 cacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------agac 460  Q
    |||||| || |||||||||||||| ||||||||||||||| |||||||||||||||||| ||||| ||||||||  |||||               | ||    
25137675 cacttggttcggatgaattcggatgacttttgcactgaaccgcgcggtttggtttggtt-gcggtatgcatctcatcaaccgaaccaaactgaaccaaac 25137577  T
461 cgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatc 522  Q
    | ||| |||||||||||||||||||||||||||||  ||||||||||||| |||||||||||    
25137576 cacaataataatgaatattacttaaacatgtactatcccaattacatagcccaagaataatc 25137515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 10390588 - 10390671
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || ||||||||||  || ||||||||||||||| |||||||| |||| | ||||||||||||||||| ||||||    
10390588 ccgcacttggttcggatgaattcaaatgacttttgcactgaaccgcgcggttcggttcgatttgcggtttgcatctcagcaacc 10390671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 373 - 456
Target Start/End: Complemental strand, 12271017 - 12270934
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||||||| || |||||| ||||||| ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
12271017 ccgcacttggttcggatgagttcggatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 12270934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 541 - 605
Target Start/End: Original strand, 10390757 - 10390821
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||| ||||||  ||||||| |||||| |||||||||||||| ||||||||||||||||    
10390757 ccattgttgcaccatcagattcgattttaattcctttccatctctttcaattcatttccagtgat 10390821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 374 - 456
Target Start/End: Original strand, 5866631 - 5866713
Alignment:
374 cgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    |||||||| || |||||| |||||||  |||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
5866631 cgcacttggttcggatgagttcggatgtcttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 5866713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 547 - 605
Target Start/End: Complemental strand, 25137490 - 25137432
Alignment:
547 ttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||| |||||| |||| |||||||||| ||||| |||||||| ||||||||||||||||    
25137490 ttgcaccatcaggttcaattctaattcatttccttctctttcaattcatttccagtgat 25137432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 393 - 449
Target Start/End: Complemental strand, 10591353 - 10591297
Alignment:
393 ttcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||| ||||||||||||||| |||||||| | || |||||||||||||| ||||    
10591353 ttcggatgacttttgcactgaaccgcgcggttcgattcggtttgcggtttgcgtctc 10591297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 597
Target Start/End: Complemental strand, 15860080 - 15860024
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcattt 597  Q
    |||||||||| ||||||  | ||||||||||||||||| ||||||||| ||||||||    
15860080 ccattgttgcaccatcagttccgattctaattcttttctatctctttcaattcattt 15860024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 542 - 588
Target Start/End: Complemental strand, 10591189 - 10591143
Alignment:
542 cattgttgctccatcaagttcgattctaattcttttccatctctttc 588  Q
    ||||||||  |||||| ||||||||||||||| ||||||||||||||    
10591189 cattgttgtaccatcaggttcgattctaattcatttccatctctttc 10591143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013 (Bit Score: 60; Significance: 3e-25; HSPs: 2)
Name: scaffold0013
Description:

Target: scaffold0013; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 373 - 605
Target Start/End: Complemental strand, 106570 - 106323
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaaccagacc----------- 461  Q
    ||||| ||| || |||||||||||||| ||||||||| ||||| |||||||| ||||||||||||||||||||||||  |||||  |||               
106570 ccgcatttggttcggatgaattcggatgacttttgcaatgaaccgcgcggttcggtttggtttgcggtttgcatctcaacaaccgaaccaaacccaacca 106471  T
462 ----gcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatca 557  Q
        ||||||||||||||||||||||||||||||||||| | |||||||||||  || ||||||                   |||||||||| ||||||    
106470 acccgcaagaataatgaatattacttaaacatgtactagcctaattacatagcctaataataatttctttttattcgatttttccattgttgcaccatca 106371  T
558 agttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    | |||||||||||||| |||||||||||||| ||||||||||||||||    
106370 aattcgattctaattcctttccatctctttcaattcatttccagtgat 106323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0013; HSP #2
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 460 - 605
Target Start/End: Complemental strand, 129075 - 128930
Alignment:
460 ccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataatcnnnnnnnnnnnnnnnnnnccattgttgctccatcaag 559  Q
    ||||||||||||||||||||||||||||||||||||| | ||||||||||| ||| |||||||                  |||||||||| |||||||     
129075 ccgcaagaataatgaatattacttaaacatgtactagcctaattacatagcccaataataatctctttatattcgatttttccattgttgcaccatcaaa 128976  T
560 ttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    |||||||||||||| |||||||||||||| |||||||| |||||||    
128975 ttcgattctaattcctttccatctctttcaattcattttcagtgat 128930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 54; Significance: 1e-21; HSPs: 5)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 373 - 521
Target Start/End: Original strand, 40122 - 40285
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc---------------a 457  Q
    ||||||||| || |||||||||||||| ||||||||||||||| ||| || | ||||||||||| ||||| ||||||  |||||               |    
40122 ccgcacttggttcggatgaattcggatgacttttgcactgaaccgcgtggctcggtttggtttgtggttttcatctcaacaaccgaaccaaaccaaacca 40221  T
458 gaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
     ||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||    
40222 aaccacaagaataatgaatattacttaaacatctactagcccaattacatagctcaagaataat 40285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 453 - 521
Target Start/End: Original strand, 47413 - 47481
Alignment:
453 aaccagaccgcaagaataatgaatattacttaaacatgtactagtccaattacatagctcaagaataat 521  Q
    ||||| ||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||    
47413 aaccaaaccacaagaataatgaatattacttaaacatctactagcccaattacatagctcaagaataat 47481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 449
Target Start/End: Original strand, 47318 - 47394
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctc 449  Q
    ||||||||| || |||||||||||||| ||||||||||||||| ||  || | ||||||||||| ||||| ||||||    
47318 ccgcacttggttcggatgaattcggatgacttttgcactgaaccgcatggctcggtttggtttgtggttttcatctc 47394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 605
Target Start/End: Original strand, 40305 - 40369
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||  ||||| |||| |||||||||  |||||||||||||| ||||||||| ||||||    
40305 ccattgttgcaacatcaggttccattctaatttatttccatctctttcaattcatttcaagtgat 40369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 541 - 605
Target Start/End: Original strand, 47501 - 47565
Alignment:
541 ccattgttgctccatcaagttcgattctaattcttttccatctctttcgattcatttccagtgat 605  Q
    ||||||||||  ||||| |||| |||||||||  |||||||||||||| ||||||||| ||||||    
47501 ccattgttgcaacatcaggttccattctaatttatttccatctctttcaattcatttcaagtgat 47565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0308 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0308
Description:

Target: scaffold0308; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 373 - 456
Target Start/End: Original strand, 5465 - 5548
Alignment:
373 ccgcacttgatttggatgaattcggataacttttgcactgaactgcgcggtttggtttggtttgcggtttgcatctctgcaacc 456  Q
    ||||| ||| || |||||| |||| || ||||||  ||||||| |||||||| |||| ||||||||||||||||||| ||||||    
5465 ccgcatttggttcggatgagttcgaatgacttttagactgaaccgcgcggttcggttcggtttgcggtttgcatctcagcaacc 5548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0204 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0204
Description:

Target: scaffold0204; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 365
Target Start/End: Complemental strand, 15146 - 15099
Alignment:
318 caactcaatagaaaaatcgcaaatcaaatcaacccaaattgaaaccgt 365  Q
    |||| ||||||||||| ||||||||||| ||||||||| |||||||||    
15146 caacccaatagaaaaaccgcaaatcaaaccaacccaaactgaaaccgt 15099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC