View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9160J-LTR4-TNT-insertion-1 (Length: 275)

Name: F9160J-LTR4-TNT-insertion-1
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9160J-LTR4-TNT-insertion-1
[»] chr7 (1 HSPs)
chr7 (9-265)||(35128726-35128982)

Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 265
Target Start/End: Complemental strand, 35128982 - 35128726
9 ggtccatccaactttaattgacccctcgcaaatggacggtaaaattgaacttctcaaattattcgatttggatatcgagttatnnnnnnnnnnnnttaca 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||    
35128982 ggtccatccaactttaattgacccctcgcaaatggacggtaaaattgaacttctcaaattattcgatttggatatcgagttataaaaaaaaaaaattaca 35128883  T
109 tagagaagagaacaagaccaaaaactttgattataaaattatctactcgaatacctactctcannnnnnnnnnnncactaaaacacattatatgacaagt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||            |||||||||||||||||||||||||    
35128882 tagagaagagaacaagaccaaaaactttgattataaaattatctactcgaatacctactttcatttttcttttttcactaaaacacattatatgacaagt 35128783  T
209 ttcttttcaattatttttgagttataattagttataatatgattaggacagaaatta 265  Q
35128782 ttcttttcaattatttttgagttataattagttataatatgattaggacagaaatta 35128726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 84057 times since January 2019
Visitors: 2323