View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9160J-LTR4-TNT-insertion-1 (Length: 275)

Name: F9160J-LTR4-TNT-insertion-1
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9160J-LTR4-TNT-insertion-1
F9160J-LTR4-TNT-insertion-1
[»] chr7 (1 HSPs)
chr7 (9-265)||(35128726-35128982)


Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 265
Target Start/End: Complemental strand, 35128982 - 35128726
Alignment:
9 ggtccatccaactttaattgacccctcgcaaatggacggtaaaattgaacttctcaaattattcgatttggatatcgagttatnnnnnnnnnnnnttaca 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||    
35128982 ggtccatccaactttaattgacccctcgcaaatggacggtaaaattgaacttctcaaattattcgatttggatatcgagttataaaaaaaaaaaattaca 35128883  T
109 tagagaagagaacaagaccaaaaactttgattataaaattatctactcgaatacctactctcannnnnnnnnnnncactaaaacacattatatgacaagt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||            |||||||||||||||||||||||||    
35128882 tagagaagagaacaagaccaaaaactttgattataaaattatctactcgaatacctactttcatttttcttttttcactaaaacacattatatgacaagt 35128783  T
209 ttcttttcaattatttttgagttataattagttataatatgattaggacagaaatta 265  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35128782 ttcttttcaattatttttgagttataattagttataatatgattaggacagaaatta 35128726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC