View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9160J-LTR4-TNT-insertion-2 (Length: 397)

Name: F9160J-LTR4-TNT-insertion-2
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9160J-LTR4-TNT-insertion-2
F9160J-LTR4-TNT-insertion-2
[»] chr3 (12 HSPs)
chr3 (12-387)||(7032489-7032864)
chr3 (270-384)||(7312962-7313076)
chr3 (270-384)||(34332655-34332769)
chr3 (270-377)||(10323411-10323518)
chr3 (270-384)||(2364463-2364577)
chr3 (275-384)||(19920074-19920183)
chr3 (291-384)||(40930389-40930482)
chr3 (276-356)||(963009-963089)
chr3 (276-356)||(3141066-3141146)
chr3 (276-359)||(48569885-48569968)
chr3 (276-356)||(2756056-2756136)
chr3 (286-353)||(17097732-17097799)
[»] chr5 (15 HSPs)
chr5 (270-384)||(31641697-31641811)
chr5 (270-384)||(28535515-28535629)
chr5 (270-384)||(35983631-35983745)
chr5 (270-384)||(30732154-30732268)
chr5 (270-384)||(12825385-12825499)
chr5 (270-384)||(27117001-27117115)
chr5 (270-384)||(42513906-42514020)
chr5 (270-381)||(23238573-23238684)
chr5 (270-384)||(42928317-42928431)
chr5 (276-356)||(24408142-24408222)
chr5 (298-386)||(27795667-27795755)
chr5 (289-356)||(18089620-18089687)
chr5 (289-356)||(33169872-33169939)
chr5 (287-338)||(27165787-27165838)
chr5 (289-330)||(22095109-22095150)
[»] chr7 (10 HSPs)
chr7 (270-384)||(17720821-17720935)
chr7 (270-381)||(11277092-11277203)
chr7 (270-384)||(47877169-47877283)
chr7 (270-384)||(235277-235391)
chr7 (270-384)||(4937968-4938082)
chr7 (267-364)||(37919750-37919847)
chr7 (270-381)||(29968163-29968274)
chr7 (289-327)||(27854301-27854339)
chr7 (289-335)||(4077510-4077556)
chr7 (287-356)||(36363738-36363807)
[»] chr8 (10 HSPs)
chr8 (270-384)||(9922787-9922901)
chr8 (270-384)||(13396574-13396688)
chr8 (266-384)||(41665205-41665323)
chr8 (270-384)||(7924572-7924686)
chr8 (270-384)||(8299989-8300103)
chr8 (270-381)||(32266751-32266862)
chr8 (270-384)||(172289-172403)
chr8 (298-386)||(13879355-13879443)
chr8 (310-359)||(25090598-25090647)
chr8 (289-333)||(12134565-12134609)
[»] chr6 (10 HSPs)
chr6 (270-384)||(21168385-21168499)
chr6 (270-380)||(2553827-2553937)
chr6 (270-345)||(24767269-24767344)
chr6 (276-356)||(13937914-13937994)
chr6 (297-347)||(18682401-18682451)
chr6 (313-359)||(14372874-14372920)
chr6 (289-327)||(26513967-26514005)
chr6 (286-327)||(33185678-33185719)
chr6 (202-259)||(33898957-33899013)
chr6 (266-338)||(5041750-5041822)
[»] chr4 (13 HSPs)
chr4 (270-384)||(15740407-15740521)
chr4 (275-384)||(47685740-47685849)
chr4 (270-384)||(19755453-19755567)
chr4 (270-384)||(19784239-19784353)
chr4 (270-384)||(23642431-23642545)
chr4 (270-384)||(47418990-47419104)
chr4 (270-384)||(1828380-1828494)
chr4 (298-386)||(54483027-54483115)
chr4 (289-356)||(46145889-46145956)
chr4 (301-344)||(48312321-48312364)
chr4 (225-259)||(28987096-28987130)
chr4 (310-359)||(2821917-2821966)
chr4 (286-359)||(5789948-5790021)
[»] chr1 (8 HSPs)
chr1 (270-384)||(11908945-11909059)
chr1 (270-384)||(6050789-6050903)
chr1 (270-384)||(35541235-35541349)
chr1 (276-353)||(2491429-2491506)
chr1 (276-356)||(31779477-31779557)
chr1 (276-327)||(22191627-22191678)
chr1 (209-255)||(6061263-6061308)
chr1 (225-259)||(11023305-11023339)
[»] scaffold0472 (1 HSPs)
scaffold0472 (270-381)||(3441-3552)
[»] scaffold0034 (1 HSPs)
scaffold0034 (270-384)||(105683-105797)
[»] chr2 (3 HSPs)
chr2 (289-384)||(41207202-41207297)
chr2 (298-359)||(40176879-40176940)
chr2 (225-259)||(36548301-36548335)


Alignment Details
Target: chr3 (Bit Score: 372; Significance: 0; HSPs: 12)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 12 - 387
Target Start/End: Complemental strand, 7032864 - 7032489
Alignment:
12 ggtggagactgcagtgaacatggaggagactggagagtcagtgagttgcgttacgttacttcagtcgtcgccggagagaagaagaagcacgcgttccagt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
7032864 ggtggagactgcagtgaacatggaggagactggagagtcagtgagttgcgttacgttacttcagtcgtcgccggagagaagaagaagcacgcgtttcagt 7032765  T
112 ttttcaccaaacgttcatttaacacttttggttccattgctacctaactacctatcttcttatctctcttaaccactcattctctcctttatatagcgtg 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7032764 ttttcaccaaacgttcatttaacacttttggttccattgctacctaactacctatcttcttatctctcttaaccactcattctctcctttatatagcgtg 7032665  T
212 tgtttggttttaacggtggtgaaaattgattttgatagagttgagtttttgagaaggtgttgcggtggcgtaggcgtttgtgggcttgggaggaagagtt 311  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7032664 tgtttggttttaacggtggtgaaaattgattttgatagagttgagtttttgagaaggtgttgcggtggcgtaggcgtttgtgggcttgggaggaagagtt 7032565  T
312 ggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatggctttggttatta 387  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7032564 ggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatggctttggttatta 7032489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 7313076 - 7312962
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| ||||||||     
7313076 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgatagac 7312977  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
7312976 agatggctctggtta 7312962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 34332655 - 34332769
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||| | ||||||||||| |||  |||     
34332655 gttgcggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggttttattactaacagtttctttgcaggaatcagtgtcagac 34332754  T
370 agatggctttggtta 384  Q
    |||||||||||||||    
34332755 agatggctttggtta 34332769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 270 - 377
Target Start/End: Original strand, 10323411 - 10323518
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||| || ||| |||||    
10323411 gttgcggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggattcagtgttagat 10323510  T
370 agatggct 377  Q
    ||||||||    
10323511 agatggct 10323518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 2364577 - 2364463
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| ||| ||||     
2364577 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgttagac 2364478  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
2364477 agatggctctggtta 2364463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 275 - 384
Target Start/End: Original strand, 19920074 - 19920183
Alignment:
275 ggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatg 374  Q
    |||| |||||| | ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| |||||||| |||||    
19920074 ggtgtcgtaggaggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgatagacagatg 19920173  T
375 gctttggtta 384  Q
    ||| ||||||    
19920174 gctctggtta 19920183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 291 - 384
Target Start/End: Original strand, 40930389 - 40930482
Alignment:
291 gtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatggctttggtta 384  Q
    |||||||||||||||||||||||||||||||| ||||| |||||||||||||||| | ||||| ||||| |||| | |||||||||||||||||    
40930389 gtgggcttgggaggaagagttggtagaggagtgtagggttttattactaacagtttctttgcaagaatcagtgacaaatagatggctttggtta 40930482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 276 - 356
Target Start/End: Original strand, 963009 - 963089
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| | || ||||||| |||||||||||| ||||||||||||| |||||  |||||||| |||||||| ||||||||    
963009 gtggcgtcgccgcttgtgggtttgggaggaagaattggtagaggagtgtagggaattattacttacagttactttgcagga 963089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 276 - 356
Target Start/End: Complemental strand, 3141146 - 3141066
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| | || ||||| | |||||||||||||||||||||||||| |||||   ||||||| |||||||| ||||||||    
3141146 gtggcgttgccgcttgtgagtttgggaggaagagttggtagaggagtgtagggaactattacttacagttactttgcagga 3141066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 276 - 359
Target Start/End: Original strand, 48569885 - 48569968
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatc 359  Q
    ||||||| | ||||| ||||  |||||||| || ||||||||||||| |||||||||| ||||||||||  | |||||||||||    
48569885 gtggcgtcgccgtttatgggtgtgggaggaggacttggtagaggagtgtagggctttactactaacagtctctttgcaggaatc 48569968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 276 - 356
Target Start/End: Complemental strand, 2756136 - 2756056
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| | || ||||||| ||||||||||||||| |||||||||| |||||   ||||||| ||| |||| ||||||||    
2756136 gtggcgtcgccgcttgtgggtttgggaggaagagtttgtagaggagtgtagggaactattacttacacttactttgcagga 2756056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 286 - 353
Target Start/End: Original strand, 17097732 - 17097799
Alignment:
286 cgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgca 353  Q
    |||||||||||||| || ||||||||||||||||||| ||||    ||||||| |||||||| |||||    
17097732 cgtttgtgggcttgagaagaagagttggtagaggagtgtaggaaactattactcacagttactttgca 17097799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 91; Significance: 5e-44; HSPs: 15)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 31641811 - 31641697
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||    
31641811 gttgaggtggcgtaggcggttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagtttcattgcaggaatcagtgacagat 31641712  T
370 agatggctttggtta 384  Q
    |||||| ||||||||    
31641711 agatggatttggtta 31641697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 28535515 - 28535629
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||| | ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||  ||| ||||    
28535515 gttgaggtggcgtaggtggttgtgggcttgagaggaagagttggtagaggagtttagggctttattactaacagtttcattgcaggaatcaatgacagat 28535614  T
370 agatggctttggtta 384  Q
    |||||||||||||||    
28535615 agatggctttggtta 28535629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 79; E-Value: 8e-37
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 35983631 - 35983745
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| |||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||| |||||||| |||| ||||    
35983631 gttgaggtggcgtaggcggttgtgggcttaggaggaggagttggtagaggagtttagggctttattactaacagtttcattacaggaatcagtgacagat 35983730  T
370 agatggctttggtta 384  Q
    |||| ||||||||||    
35983731 agatagctttggtta 35983745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 30732154 - 30732268
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| ||||||||     
30732154 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgatagac 30732253  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
30732254 agatggctctggtta 30732268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 12825499 - 12825385
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| |||||||||||||| || |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| ||||||||     
12825499 gttgaggtggcgtaggcggttgtgggcttgggatgaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgatagac 12825400  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
12825399 agatggctctggtta 12825385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 27117001 - 27117115
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| |||||||| |||||||| | |||||||||||||| ||||||||| |||||||||||| | ||||||||||| ||||||||     
27117001 gttgaggtggcgtaggcggttgtgggcctgggaggaggggttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgatagac 27117100  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
27117101 agatggctatggtta 27117115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 42514020 - 42513906
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||| || ||| ||||     
42514020 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggactcagtgttagac 42513921  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
42513920 agatggctctggtta 42513906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 270 - 381
Target Start/End: Complemental strand, 23238684 - 23238573
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||| | ||||||||  ||||||| |||||||||||||||| |||||||||||| ||||||||| | ||||||||||| |||| |||     
23238684 gttgcggtggcgtaggaggttgtgggccagggaggaggagttggtagaggagtgtagggctttattgctaacagtttctttgcaggaatcagtgacagac 23238585  T
370 agatggctttgg 381  Q
    ||||||||||||    
23238584 agatggctttgg 23238573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 42928431 - 42928317
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    ||||| ||||||| |||| |||||||||||||||||||||||||||||||||| ||||| ||||||||| || |||   || |||||||| |||| ||||    
42928431 gttgcagtggcgtcggcggttgtgggcttgggaggaagagttggtagaggagtgtagggttttattacttaccgtttttttacaggaatcagtgacagat 42928332  T
370 agatggctttggtta 384  Q
    |||||| | ||||||    
42928331 agatggttgtggtta 42928317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 276 - 356
Target Start/End: Complemental strand, 24408222 - 24408142
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| | || |||||||||||||||||||||||||||||||||| |||||   ||||||| |||||||| ||||||||    
24408222 gtggcgtcgtcgcttgtgggcttgggaggaagagttggtagaggagtgtagggaactattacttacagttactttgcagga 24408142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 298 - 386
Target Start/End: Complemental strand, 27795755 - 27795667
Alignment:
298 tgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatggctttggttatt 386  Q
    |||||||| || ||||||||||||| |||||||||||||||||||||| | ||| ||||||| || |  ||||||||| | ||||||||    
27795755 tgggaggaggacttggtagaggagtgtagggctttattactaacagtttctttggaggaatccgttactgatagatgggtgtggttatt 27795667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 289 - 356
Target Start/End: Original strand, 18089620 - 18089687
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    |||||||||||||||||| ||||| ||||||||| ||||| | | ||||| |||||||||||||||||    
18089620 ttgtgggcttgggaggaaaagttgatagaggagtgtagggatcttttacttacagttacattgcagga 18089687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 289 - 356
Target Start/End: Complemental strand, 33169939 - 33169872
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| ||||||||| |||||||||||||||| |||||  |||||||| |||||||| ||||||||    
33169939 ttgtgggtttgggaggacgagttggtagaggagtgtagggaattattacttacagttactttgcagga 33169872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 287 - 338
Target Start/End: Original strand, 27165787 - 27165838
Alignment:
287 gtttgtgggcttgggaggaagagttggtagaggagtttagggctttattact 338  Q
    |||||||||||||| ||||||||||||||||| ||| |||||  ||||||||    
27165787 gtttgtgggcttggaaggaagagttggtagagtagtgtagggaattattact 27165838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 289 - 330
Target Start/End: Original strand, 22095109 - 22095150
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagggct 330  Q
    |||||||| |||||||| |||||| |||||||||||||||||    
22095109 ttgtgggcgtgggaggaggagttgttagaggagtttagggct 22095150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 88; Significance: 3e-42; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 17720935 - 17720821
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |||| ||||    
17720935 gttgaggtggcgtaggcggttgtgggcttgggaggaagagttggtagaggagtttanggctttattactaacagtttcattgcaggaatcagtgacagat 17720836  T
370 agatggctttggtta 384  Q
    |||||| ||||||||    
17720835 agatggatttggtta 17720821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 270 - 381
Target Start/End: Original strand, 11277092 - 11277203
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||| ||||||||| | ||||||||||| |||| |||     
11277092 gttgcggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttattgctaacagtttctttgcaggaatcagtgacagac 11277191  T
370 agatggctttgg 381  Q
    ||||||||||||    
11277192 agatggctttgg 11277203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 47877283 - 47877169
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||| | ||| |||||||||||||||| | ||||||||||| |||| |||     
47877283 gttgcggtggcgtaggcggttgtgggcttgggaggaagagttggtagaggagtgtggggttttattactaacagtttccttgcaggaatcagtgacagac 47877184  T
370 agatggctttggtta 384  Q
    ||||| |||||||||    
47877183 agatgactttggtta 47877169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 235277 - 235391
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||  ||| |||||||||||||||||| ||||||||||||||| ||||| |||||||||||||||| | || |||||||| |||| ||||    
235277 gttgcggtggcgtcagcgattgtgggcttgggaggaaaagttggtagaggagtgtagggttttattactaacagtttccttacaggaatcagtgacagat 235376  T
370 agatggctttggtta 384  Q
    ||||| |||||||||    
235377 agatgactttggtta 235391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 4937968 - 4938082
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||| || ||| ||||     
4937968 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggactcagtgttagac 4938067  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
4938068 agatggctctggtta 4938082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 267 - 364
Target Start/End: Complemental strand, 37919847 - 37919750
Alignment:
267 ggtgttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtga 364  Q
    ||||||||||||||||||||| |||||||||||||||||  ||||||||||||||| ||| | |||||||||||||||| | ||||||||||| ||||    
37919847 ggtgttgcggtggcgtaggcggttgtgggcttgggaggagaagttggtagaggagtgtagagttttattactaacagtttctttgcaggaatcagtga 37919750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 270 - 381
Target Start/End: Complemental strand, 29968274 - 29968163
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||| | || |||||||| ||||| || ||||||||||||| |||||||||||| ||||||||| | ||||||||||| |||| |||     
29968274 gttgcggtggcgtaggaggttatgggcttgagaggaggaattggtagaggagtgtagggctttattgctaacagtttctttgcaggaatcagtgacagac 29968175  T
370 agatggctttgg 381  Q
    ||||||||||||    
29968174 agatggctttgg 29968163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 289 - 327
Target Start/End: Original strand, 27854301 - 27854339
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagg 327  Q
    ||||||||||||||||||||||||||||||||| |||||    
27854301 ttgtgggcttgggaggaagagttggtagaggagcttagg 27854339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 335
Target Start/End: Complemental strand, 4077556 - 4077510
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagggctttatt 335  Q
    |||||||||||||||||||||  | ||||||||| ||||||||||||    
4077556 ttgtgggcttgggaggaagaggagttagaggagtgtagggctttatt 4077510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 356
Target Start/End: Complemental strand, 36363807 - 36363738
Alignment:
287 gtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    |||||||||  |||||||||||| || ||||||||| |||||| |||||||| || ||| | ||||||||    
36363807 gtttgtgggtgtgggaggaagagctgctagaggagtgtagggcattattacttactgtttctttgcagga 36363738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 87; Significance: 1e-41; HSPs: 10)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 9922901 - 9922787
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |||| ||||    
9922901 gttgaggtggcgtaggcggttgtgggcttgggaggaagagttggtagaggagtctagggctttattactaacagtttcattgcaggaatcagtgacagat 9922802  T
370 agatggctttggtta 384  Q
    |||||| ||||||||    
9922801 agatggatttggtta 9922787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 13396688 - 13396574
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||| ||||||||||||| || | ||||||||||| |||| |||     
13396688 gttgcggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggttttattactaacaatttctttgcaggaatcagtgacagac 13396589  T
370 agatggctttggtta 384  Q
    |||||||||||||||    
13396588 agatggctttggtta 13396574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 266 - 384
Target Start/End: Original strand, 41665205 - 41665323
Alignment:
266 aggtgttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgat 365  Q
    |||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||| |||||||||||||||| | || |||||||| ||||     
41665205 aggtgttgcggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggttttattactaacagtttctttacaggaatcagtgac 41665304  T
366 agatagatggctttggtta 384  Q
    ||| ||||| |||||||||    
41665305 agacagatgactttggtta 41665323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 7924686 - 7924572
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||| || ||| ||||     
7924686 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggactcagtgttagac 7924587  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
7924586 agatggctctggtta 7924572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 8300103 - 8299989
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| |||||||| |||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| ||| ||||     
8300103 gttgaggtggcgtcggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgttagac 8300004  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
8300003 agatggctctggtta 8299989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 270 - 381
Target Start/End: Complemental strand, 32266862 - 32266751
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||| | |||||||| |||||||| |||||||||||||||| |||||||||||| ||||||||| | ||||||||||| |||  |||     
32266862 gttgcggtggcgtaggaggttgtgggcctgggaggaggagttggtagaggagtgtagggctttattgctaacagtttctttgcaggaatcagtgtcagac 32266763  T
370 agatggctttgg 381  Q
    ||||||||||||    
32266762 agatggctttgg 32266751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 172403 - 172289
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| |||||||| ||||||||  ||||||||||||||| ||||||||| ||||||| |||| | ||||||||||| ||||||||     
172403 gttgaggtggcgtaggcggttgtgggcctgggaggagaagttggtagaggagtgtagggctttgttactaatagtttctttgcaggaatcagtgatagac 172304  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
172303 agatggctatggtta 172289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 298 - 386
Target Start/End: Original strand, 13879355 - 13879443
Alignment:
298 tgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatggctttggttatt 386  Q
    |||||||| || ||||||||||||| |||||||||||||||||||||  | ||||||||||| || |  ||||||||| | ||||||||    
13879355 tgggaggaggacttggtagaggagtgtagggctttattactaacagtctctttgcaggaatccgttactgatagatgggtgtggttatt 13879443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 310 - 359
Target Start/End: Complemental strand, 25090647 - 25090598
Alignment:
310 ttggtagaggagtttagggctttattactaacagttacattgcaggaatc 359  Q
    ||||||||||||| |||||||||||||||||||||  | |||||||||||    
25090647 ttggtagaggagtgtagggctttattactaacagtctctttgcaggaatc 25090598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 289 - 333
Target Start/End: Complemental strand, 12134609 - 12134565
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagggcttta 333  Q
    |||||||| |||||||| || ||||||||||||| ||||||||||    
12134609 ttgtgggcgtgggaggaggacttggtagaggagtgtagggcttta 12134565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 83; Significance: 3e-39; HSPs: 10)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 21168499 - 21168385
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| | ||||||||||| |||| |||     
21168499 gttgcggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttattactaacagtttctttgcaggaatcagtgacagac 21168400  T
370 agatggctttggtta 384  Q
    |||||||||||||||    
21168399 agatggctttggtta 21168385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 380
Target Start/End: Complemental strand, 2553937 - 2553827
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| ||||||||||||||| |  |||||||| |||||| |||||||||||||||||||||| | ||||||||||| |||| |||     
2553937 gttgcggtggcgtaggcggttgtgggcttgggagtagaagttggtaaaggagtgtagggctttattactaacagtttctttgcaggaatcagtgacagac 2553838  T
370 agatggctttg 380  Q
    |||||||||||    
2553837 agatggctttg 2553827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 270 - 345
Target Start/End: Original strand, 24767269 - 24767344
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagtt 345  Q
    ||||||||||||| | || |||||||||||||||||||||||||||||||||| ||||| | ||||||||||||||    
24767269 gttgcggtggcgtcgacggttgtgggcttgggaggaagagttggtagaggagtgtagggttgtattactaacagtt 24767344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 276 - 356
Target Start/End: Complemental strand, 13937994 - 13937914
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| | || ||||||| |||||||||||||||||||||||||| |||||  |||||||| |||||||| ||||||||    
13937994 gtggcgtcgccgcttgtgggtttgggaggaagagttggtagaggagtgtagggaattattacttacagttactttgcagga 13937914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 297 - 347
Target Start/End: Original strand, 18682401 - 18682451
Alignment:
297 ttgggaggaagagttggtagaggagtttagggctttattactaacagttac 347  Q
    ||||||||||||||||| |||||||| ||||||| ||||||| ||||||||    
18682401 ttgggaggaagagttggcagaggagtgtagggctctattactcacagttac 18682451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 313 - 359
Target Start/End: Original strand, 14372874 - 14372920
Alignment:
313 gtagaggagtttagggctttattactaacagttacattgcaggaatc 359  Q
    |||||||||| ||||||||||||||| |||||| | |||||||||||    
14372874 gtagaggagtgtagggctttattactgacagtttctttgcaggaatc 14372920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 289 - 327
Target Start/End: Complemental strand, 26514005 - 26513967
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagg 327  Q
    ||||||||||||||||| |||||||||||||||| ||||    
26514005 ttgtgggcttgggaggaggagttggtagaggagtgtagg 26513967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 327
Target Start/End: Complemental strand, 33185719 - 33185678
Alignment:
286 cgtttgtgggcttgggaggaagagttggtagaggagtttagg 327  Q
    ||||||||| | ||||||||||||||||||||||||| ||||    
33185719 cgtttgtggacatgggaggaagagttggtagaggagtgtagg 33185678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 259
Target Start/End: Original strand, 33898957 - 33899013
Alignment:
202 atatagcgtgtgtttggttttaacggtggtgaaaattgattttgatagagttgagttt 259  Q
    |||||| ||||||||||| | | ||||||||| |||||||||||||||| ||||||||    
33898957 atatagtgtgtgtttggtat-agcggtggtgagaattgattttgatagaattgagttt 33899013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 266 - 338
Target Start/End: Complemental strand, 5041822 - 5041750
Alignment:
266 aggtgttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattact 338  Q
    |||||| | |||||||| |  |||||||||  ||||||||||||||| ||||||||| |||||| ||| ||||    
5041822 aggtgtggaggtggcgtcgtggtttgtgggtgtgggaggaagagttgttagaggagtgtagggcattactact 5041750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 75; Significance: 2e-34; HSPs: 13)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 15740521 - 15740407
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    ||||| ||||| |||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| | ||||||||||| |||| |||     
15740521 gttgcagtggcataggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttattactaacagtttctttgcaggaatcagtgacagac 15740422  T
370 agatggctttggtta 384  Q
    |||||||||||||||    
15740421 agatggctttggtta 15740407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 275 - 384
Target Start/End: Original strand, 47685740 - 47685849
Alignment:
275 ggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatg 374  Q
    |||||||| ||||  |||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||||||||||||||| |||||    
47685740 ggtggcgtgggcggctgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcggtgatagacagatg 47685839  T
375 gctttggtta 384  Q
    ||||||||||    
47685840 gctttggtta 47685849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 19755567 - 19755453
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| |||||||||| |||||| |||||||||||||||| ||||| ||||||||||| |||| | ||||||||||| |||| |||     
19755567 gttgcggtggcgtaggcggttgtgggcttaggaggaggagttggtagaggagtgtagggttttattactaatagtttctttgcaggaatcagtgacagac 19755468  T
370 agatggctttggtta 384  Q
    |||||||||||||||    
19755467 agatggctttggtta 19755453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 19784239 - 19784353
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| |||||||||| |||||| |||||||||||||||| ||||| ||||||||||| |||| | ||||||||||| |||| |||     
19784239 gttgcggtggcgtaggcggttgtgggcttaggaggaggagttggtagaggagtgtagggttttattactaatagtttctttgcaggaatcagtgacagac 19784338  T
370 agatggctttggtta 384  Q
    |||||||||||||||    
19784339 agatggctttggtta 19784353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 23642431 - 23642545
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||| || ||| ||||     
23642431 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggactcagtgttagac 23642530  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
23642531 agatggctctggtta 23642545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 47419104 - 47418990
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||||| ||||||||||||||||| ||| |||||||||||| ||||||||| ||||||||| || | |||||||| || ||| |||||    
47419104 gttgcggtggcgtaggcggttgtgggcttgggaggaggaggtggtagaggagtgtagggctttgttactaacaatttctttgcaggattcagtgttagat 47419005  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
47419004 agatggctctggtta 47418990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 1828380 - 1828494
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| |||||| |||||| ||||||||||||||||| ||||||||||||||||  ||||||||||||||||||||| | |||||||| || ||||  ||     
1828380 gttgtggtggcataggcggttgtgggcttgggaggaggagttggtagaggagtggagggctttattactaacagtttctttgcaggattcagtgactgac 1828479  T
370 agatggctttggtta 384  Q
    | |||||||||||||    
1828480 aaatggctttggtta 1828494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 298 - 386
Target Start/End: Original strand, 54483027 - 54483115
Alignment:
298 tgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatggctttggttatt 386  Q
    |||||||| || ||||||||||||| ||||| |||||||||||||||  | ||||||||||| || |  ||||||||| | ||||||||    
54483027 tgggaggaggatttggtagaggagtgtaggggtttattactaacagtctctttgcaggaatccgttactgatagatgggtgtggttatt 54483115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 289 - 356
Target Start/End: Complemental strand, 46145956 - 46145889
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| ||||||||||||||||| |||||||| |||||   ||||||| |||||||| ||||||||    
46145956 ttgtgggtttgggaggaagagttggcagaggagtgtagggaactattacttacagttactttgcagga 46145889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 301 - 344
Target Start/End: Complemental strand, 48312364 - 48312321
Alignment:
301 gaggaagagttggtagaggagtttagggctttattactaacagt 344  Q
    ||||| || ||||||||||||| |||||||||||||||||||||    
48312364 gaggaggacttggtagaggagtgtagggctttattactaacagt 48312321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 259
Target Start/End: Complemental strand, 28987130 - 28987096
Alignment:
225 cggtggtgaaaattgattttgatagagttgagttt 259  Q
    |||||||||||||||||||||||||| ||||||||    
28987130 cggtggtgaaaattgattttgatagaattgagttt 28987096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 310 - 359
Target Start/End: Original strand, 2821917 - 2821966
Alignment:
310 ttggtagaggagtttagggctttattactaacagttacattgcaggaatc 359  Q
    ||||||||||||| |||||||||| ||||||||||  | |||||||||||    
2821917 ttggtagaggagtgtagggctttaatactaacagtctctttgcaggaatc 2821966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 359
Target Start/End: Original strand, 5789948 - 5790021
Alignment:
286 cgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatc 359  Q
    ||||||| ||| ||||||||||| ||||||||||||| |||||   | ||||| |||||||| ||| |||||||    
5789948 cgtttgtaggcgtgggaggaagatttggtagaggagtgtagggagcttttacttacagttactttgtaggaatc 5790021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 75; Significance: 2e-34; HSPs: 8)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 11908945 - 11909059
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | ||||||||||| ||||||||     
11908945 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggaatcagtgatagac 11909044  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
11909045 agatggctctggtta 11909059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 6050903 - 6050789
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||| || ||| ||||     
6050903 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggactcagtgttagac 6050804  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
6050803 agatggctctggtta 6050789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 270 - 384
Target Start/End: Complemental strand, 35541349 - 35541235
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| |||||||| |||| ||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||   ||||||||||| ||| ||||     
35541349 gttgaggtggcgtcggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttttttgcaggaatcagtgttagac 35541250  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
35541249 agatggctctggtta 35541235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 276 - 353
Target Start/End: Complemental strand, 2491506 - 2491429
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgca 353  Q
    ||||||| | ||||||||||||||||||||||||||||||||||||| |||||   ||||||| |||||||| |||||    
2491506 gtggcgtcgtcgtttgtgggcttgggaggaagagttggtagaggagtgtagggtactattacttacagttactttgca 2491429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 276 - 356
Target Start/End: Complemental strand, 31779557 - 31779477
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcagga 356  Q
    ||||||| | ||||||| || || ||| ||||||||||||||||||| |||||   ||||||| |||||||||||||||||    
31779557 gtggcgtcgccgtttgttggtttaggatgaagagttggtagaggagtgtagggaactattactcacagttacattgcagga 31779477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 276 - 327
Target Start/End: Original strand, 22191627 - 22191678
Alignment:
276 gtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagg 327  Q
    |||||||||||| |||||||| |||||||| |||||||||| ||||| ||||    
22191627 gtggcgtaggcggttgtgggcatgggaggaggagttggtaggggagtgtagg 22191678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 209 - 255
Target Start/End: Complemental strand, 6061308 - 6061263
Alignment:
209 gtgtgtttggttttaacggtggtgaaaattgattttgatagagttga 255  Q
    ||||||||||||| | |||||||||||||||||||||||||| ||||    
6061308 gtgtgtttggtttga-cggtggtgaaaattgattttgatagaattga 6061263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 259
Target Start/End: Original strand, 11023305 - 11023339
Alignment:
225 cggtggtgaaaattgattttgatagagttgagttt 259  Q
    |||||||||||||||||||||||||| ||||||||    
11023305 cggtggtgaaaattgattttgatagaattgagttt 11023339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0472 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: scaffold0472
Description:

Target: scaffold0472; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 270 - 381
Target Start/End: Complemental strand, 3552 - 3441
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||||||||||||||| | |||||||| |||||||| |||||||||||||||| |||||||||||||||||||||| | || |||||||| |||| |||     
3552 gttgcggtggcgtaggaggttgtgggcctgggaggaggagttggtagaggagtgtagggctttattactaacagtttctttacaggaatcagtgacagac 3453  T
370 agatggctttgg 381  Q
    ||||||||||||    
3452 agatggctttgg 3441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 270 - 384
Target Start/End: Original strand, 105683 - 105797
Alignment:
270 gttgcggtggcgtaggcgtttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagat 369  Q
    |||| ||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||| |||||||||||| | |||||||| || ||| ||||     
105683 gttgaggtggcgtaggcggttgtgggcttgggaggaggagttggtagaggagtgtagggctttgttactaacagtttctttgcaggactcagtgttagac 105782  T
370 agatggctttggtta 384  Q
    |||||||| ||||||    
105783 agatggctctggtta 105797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 3e-18; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 289 - 384
Target Start/End: Complemental strand, 41207297 - 41207202
Alignment:
289 ttgtgggcttgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatcggtgatagatagatggctttggtta 384  Q
    |||||||| ||||||||||||||||||||||||| ||||| ||||||| | |||||| | ||||||||||| |||  |||||||||| | ||||||    
41207297 ttgtgggcatgggaggaagagttggtagaggagtgtagggttttattatttacagtttccttgcaggaatcagtggcagatagatggttgtggtta 41207202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 298 - 359
Target Start/End: Complemental strand, 40176940 - 40176879
Alignment:
298 tgggaggaagagttggtagaggagtttagggctttattactaacagttacattgcaggaatc 359  Q
    |||||||| || ||||||||||||| |||||||||||||||||||||  | |||||||||||    
40176940 tgggaggaggacttggtagaggagtgtagggctttattactaacagtctctttgcaggaatc 40176879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 259
Target Start/End: Complemental strand, 36548335 - 36548301
Alignment:
225 cggtggtgaaaattgattttgatagagttgagttt 259  Q
    |||||||||||||||||||||||||| ||||||||    
36548335 cggtggtgaaaattgattttgatagaattgagttt 36548301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC