View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9160J-LTR4-TNT-insertion-5 (Length: 449)

Name: F9160J-LTR4-TNT-insertion-5
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9160J-LTR4-TNT-insertion-5
F9160J-LTR4-TNT-insertion-5
[»] chr2 (1 HSPs)
chr2 (8-439)||(15241625-15242056)
[»] chr6 (1 HSPs)
chr6 (160-218)||(34227386-34227444)
[»] chr1 (1 HSPs)
chr1 (170-218)||(33651744-33651792)


Alignment Details
Target: chr2 (Bit Score: 432; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 432; E-Value: 0
Query Start/End: Original strand, 8 - 439
Target Start/End: Complemental strand, 15242056 - 15241625
Alignment:
8 catcaatgtagcattatgcaagtttggaaatacaacaatattcccaagattacatccaactcttttaaaccaattccctaaaattgcaacaaacaagttg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15242056 catcaatgtagcattatgcaagtttggaaatacaacaatattcccaagattacatccaactcttttaaaccaattccctaaaattgcaacaaacaagttg 15241957  T
108 acttatactatcgtagagaatcaaaagacttgaccaaaacacagaacaaaatatcagtgttttcaaatgcagatcacggaaaatgatagtttgttcaaat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15241956 acttatactatcgtagagaatcaaaagacttgaccaaaacacagaacaaaatatcagtgttttcaaatgcagatcacggaaaatgatagtttgttcaaat 15241857  T
208 ttaactacacaccacaccactatagacctatttgacaacattttgtgctaatagagagtattgcaaaacaacattgtaaacgatttactgcaacaaaaga 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15241856 ttaactacacaccacaccactatagacctatttgacaacattttgtgctaatagagagtattgcaaaacaacattgtaaacgatttactgcaacaaaaga 15241757  T
308 acatcattaacgtcacattatcatataacaacaagaagggataaattagatagtgcctcatagtggtctccactttaaaaccaattcatcgaaattattt 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
15241756 acatcattaacgtcacattatcatataacaacaagaagggataaattagatagtgcctcatagtggtctccactttaaaaccaattcatcgaaattattt 15241657  T
408 gaaacaatttgattaatcctactctatgaatt 439  Q
    ||||||||||||||||||||||||||||||||    
15241656 gaaacaatttgattaatcctactctatgaatt 15241625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 160 - 218
Target Start/End: Complemental strand, 34227444 - 34227386
Alignment:
160 atcagtgttttcaaatgcagatcacggaaaatgatagtttgttcaaatttaactacaca 218  Q
    ||||||||| |||| ||| ||||| ||||||| | ||||||||||||||| ||||||||    
34227444 atcagtgttgtcaattgccgatcatggaaaataacagtttgttcaaatttcactacaca 34227386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 170 - 218
Target Start/End: Complemental strand, 33651792 - 33651744
Alignment:
170 tcaaatgcagatcacggaaaatgatagtttgttcaaatttaactacaca 218  Q
    |||| |||||||||| ||||||  ||||||||||||||||| |||||||    
33651792 tcaattgcagatcacagaaaatagtagtttgttcaaatttagctacaca 33651744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93506 times since January 2019
Visitors: 2365