View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-1 (Length: 769)

Name: F9164J-LTR4-TNT-insertion-1
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-1
F9164J-LTR4-TNT-insertion-1
[»] chr3 (3 HSPs)
chr3 (8-769)||(35708534-35709295)
chr3 (50-769)||(35724437-35725156)
chr3 (64-769)||(35725585-35726290)
[»] chr8 (1 HSPs)
chr8 (713-753)||(22512568-22512608)


Alignment Details
Target: chr3 (Bit Score: 758; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 758; E-Value: 0
Query Start/End: Original strand, 8 - 769
Target Start/End: Complemental strand, 35709295 - 35708534
Alignment:
8 attaagaaccaaagataaacatcacatttgattattcatatataccaaactaggtttaaatggatatgctgtatgggactccttttccagtgactccagg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35709295 attaagaaccaaagataaacatcacatttgattattcatatataccaaactaggtttaaatggatatgctgtatgggactccttttccagtgactccagg 35709196  T
108 ccctgaaaatggctttaaagactcataaggcattatcccagctccatttctattcttcaaattcttgtttttattccttgagtctataataccttcaatc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35709195 ccctgaaaatggctttaaagactcataaggcattatcccagctccatttctattcttcaaattcttgtttttattccttgagtctataataccttcaatc 35709096  T
208 tctttcaatctcctatgaaatctttcaaaagctgcttttatagttggattctcaccccaagatggctctattttttgtccaatatactcttcatctgctg 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35709095 tctttcaatctcctatgaaatctttcaaaagctgcttttatagttggattctcaccccaagatggctctattttttgtccaatatactcttcatctgctg 35708996  T
308 aatgctctgataatatgttcattataaccgtaaacaaggttgcttgaatttgtgatggaaagcactccaaaagtgtttgttctggtttgttaataaattt 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35708995 aatgctctgataatatgttcattataaccgtaaacaaggttgcttgaatttgtgatggaaagcactccaaaagtgtttgttctggtttgttaataaattt 35708896  T
408 ttcccattcttccttggtagggtcttctgttggcattttgtttcttgcaattgttggtctattaggaaaaaagcctatataagcatattgtgtgaagttc 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35708895 ttcccattcttccttggtagggtcttctgttggcattttgtttcttgcaattgttggtctattaggaaaaaagcctatataagcatattgtgtgaagttc 35708796  T
508 acagctgcatgatgagcagaggctatccaagttatagtagtgatgatatcagtaagatctttttgtgttttgagatttggccaccatggttcttcagatt 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35708795 acagctgcatgatgagcagaggctatccaagttatagtagtgatgatatcagtaagatctttttgtgttttgagatttggccaccatggttcttcagatt 35708696  T
608 tgtctgcatgtcccactgttcgaatttctgtccaccatgcttggagctcttgatcagactctacaatgctcgagcttggatagtaatgattgacataatc 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35708695 tgtctgcatgtcccactgttcgaatttctgtccaccatgcttggagctcttgatcagactctacaatgctcgagcttggatagtaatgattgacataatc 35708596  T
708 tgtcacccattgtttgattgcatcccatattagaagaccatcattggcaaaaaggtagtctt 769  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
35708595 tgtcacccattgtttgattgcatcccatattagaagaccatcattggcaaaagggtagtctt 35708534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 461; E-Value: 0
Query Start/End: Original strand, 50 - 769
Target Start/End: Complemental strand, 35725156 - 35724437
Alignment:
50 taccaaactaggtttaaatggatatgctgtatgggactccttttccagtgactccaggccctgaaaatggctttaaagactcataaggcattatcccagc 149  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||  || |||||    
35725156 taccacactaggtttaaatggatatgctgtatgggactccttttccagtgactccaggccctgaaaatggctttaaggactcataaggcacaataccagc 35725057  T
150 tccatttctattcttcaaattcttgtttttattccttgagtctataataccttcaatctctttcaatctcctatgaaatctttcaaaagctgcttttata 249  Q
    ||||| ||||||||||| |||| | | || ||||||||||||||||||||||||||| || ||||||||||| || ||  ||||||||||||| ||||||    
35725056 tccatgtctattcttcatattcctatcttcattccttgagtctataataccttcaatttcattcaatctcctttgtaacttttcaaaagctgcctttata 35724957  T
250 gttggattctcaccccaagatggctctattttttgtccaatatactcttcatctgctgaatgctctgataatatgttcattataaccgtaaacaaggttg 349  Q
    |||| |||||||||||||||||||||||||||||||||||| ||||||||||| | |||||| || ||||||||| |||| | || | |||| |||||||    
35724956 gttgaattctcaccccaagatggctctattttttgtccaatgtactcttcatcgggtgaatgttccgataatatgctcataacaatcataaataaggttg 35724857  T
350 cttgaatttgtgatggaaagcactccaaaagtgtttgttctggtttgttaataaatttttcccattcttccttggtagggtcttctgttggcattttgtt 449  Q
    ||||||||||||||||||| || |||||||||||||| ||||| | ||| ||||||||||||||||||||||| |||||||||||||| |||||||| ||    
35724856 cttgaatttgtgatggaaaacattccaaaagtgtttgctctggatggttcataaatttttcccattcttccttagtagggtcttctgtaggcattttctt 35724757  T
450 tcttgcaattgttggtctattaggaaaaaagcctatataagcatattgtgtgaagttcacagctgcatgatgagcagaggctatccaagttatagtagtg 549  Q
    ||| ||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||| ||     
35724756 tctagcaatggttggtctattagggaaaaagcctatataagcatattgtgtaaagttcacagctgaatgatgagcagatgctgtccaagctatagtggta 35724657  T
550 atgatatcagtaagatctttttgtgttttgagatttggccaccatggttcttcagatttgtctgcatgtcccactgttcgaatttctgtccaccatgctt 649  Q
    ||||| | | ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
35724656 atgatgttaataagatcattttgtgttttgagatttggccaccatggttcttcagatttgtccgcatgtcccactgttcgaatttctgtccaccatgctt 35724557  T
650 ggagctcttgatcagactctacaatgctc-gagcttggatagtaatgattgacataatctgtcacccattgtttgattgcatcccatattagaagaccat 748  Q
    |||||||||||||||| |||| | | ||| |||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||    
35724556 ggagctcttgatcagattctatagt-ctctgagcttggatagtaatgattgacatattctgtgacccattgtttaattgcatcccatattagaagaccat 35724458  T
749 cattggcaaaaaggtagtctt 769  Q
    ||||||||||| |||||||||    
35724457 cattggcaaaagggtagtctt 35724437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 282; E-Value: 1e-157
Query Start/End: Original strand, 64 - 769
Target Start/End: Original strand, 35725585 - 35726290
Alignment:
64 taaatggatatgctgtatgggactccttttccagtgactccaggccctgaaaatggctttaaagactcataaggcattatcccagctccatttctattct 163  Q
    ||||| |||||||| ||||| ||||||||||||||||||||||| ||||||||||| || |    |||||| |||| ||||||||||||||| ||||| |    
35725585 taaatagatatgctatatggaactccttttccagtgactccaggtcctgaaaatggtttcattagctcatatggcactatcccagctccattcctatttt 35725684  T
164 tcaaattcttgtttttattccttgagtctataataccttcaatctctttcaatctcctatgaaatctttcaaaagctgcttttatagttggattctcacc 263  Q
    | |||||  | |||  ||| ||||||||||| ||| ||||||| || |||||||||| || ||| |||||||| ||| | ||||||| |||||||||| |    
35725685 tgaaattactatttgcatttcttgagtctattataacttcaatttccttcaatctcccattaaacctttcaaatgctacctttatagctggattctcagc 35725784  T
264 ccaagatggctctattttttgtccaatatactcttcatctgctgaatgctctgataatatgttcattataaccgtaaacaaggttgcttgaatttgtgat 363  Q
    ||| ||||| || ||   |||||| |  ||||||||||||| |||||| | |||||||| |||||  ||   | | |  ||||||||||||||||||||     
35725785 ccatgatggttcaatgagttgtcccaagtactcttcatctggtgaatgatatgataataagttcaaaatggtcatcactaaggttgcttgaatttgtgaa 35725884  T
364 ggaaagcactccaaaagtgtttgttctggtttgttaataaatttttcccattcttccttggtagggtcttctgttggcattttgtttcttgcaattgttg 463  Q
    || || ||||||||||||||||| || || ||||| | |||||| |||||||||||||| |||||||||||||| ||||| |||||||| ||||||||||    
35725885 gggaaacactccaaaagtgtttgctcaggcttgttcagaaatttctcccattcttcctttgtagggtcttctgtaggcatgttgtttctagcaattgttg 35725984  T
464 gtctattaggaaaaaagcctatataagcatattgtgtgaagttcacagctgcatgatgagcagaggctatccaagttatagtagtgatgatatcagtaag 563  Q
    |||||||||||||| |||||  |||||||||||||| ||||||    |||| |||||| ||||| |||| ||||| |||||| |||||||| ||| | ||    
35725985 gtctattaggaaaatagcctccataagcatattgtgcgaagtttgttgctgaatgatgtgcagatgctacccaagctatagtggtgatgatgtcaatgag 35726084  T
564 atctttttgtgttttgagatttggccaccatggttcttcagatttgtctgcatgtcccactgttcgaatttctgtccaccatgcttggagctcttgatca 663  Q
     |||||||||||||| ||||||||||||||||||||||| ||||||||  | || ||   |||||||| |||||||||||||||||| ||||||||||||    
35726085 gtctttttgtgttttcagatttggccaccatggttcttctgatttgtcgccgtggccttttgttcgaacttctgtccaccatgcttgaagctcttgatca 35726184  T
664 gactctacaatgctcgagcttggatagtaatgattgacataatctgtcacccattgtttgattgcatcccatattagaagaccatcattggcaaaaaggt 763  Q
    || ||||  ||||| |   ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
35726185 gattctatgatgcttggatttggatagtaatgattgacataatctgtcacccattgtttgattgcatcccatatgagaagaccatcattggcaaaagggt 35726284  T
764 agtctt 769  Q
    ||||||    
35726285 agtctt 35726290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 713 - 753
Target Start/End: Original strand, 22512568 - 22512608
Alignment:
713 cccattgtttgattgcatcccatattagaagaccatcattg 753  Q
    |||||||||| ||||||||||||||| ||||||||||||||    
22512568 cccattgtttaattgcatcccatatttgaagaccatcattg 22512608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC