View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-1 (Length: 769)

Name: F9164J-LTR4-TNT-insertion-1
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-1
[»] chr3 (3 HSPs)
chr3 (8-769)||(35708534-35709295)
chr3 (50-769)||(35724437-35725156)
chr3 (64-769)||(35725585-35726290)
[»] chr8 (1 HSPs)
chr8 (713-753)||(22512568-22512608)

Alignment Details
Target: chr3 (Bit Score: 758; Significance: 0; HSPs: 3)
Name: chr3

Target: chr3; HSP #1
Raw Score: 758; E-Value: 0
Query Start/End: Original strand, 8 - 769
Target Start/End: Complemental strand, 35709295 - 35708534
8 attaagaaccaaagataaacatcacatttgattattcatatataccaaactaggtttaaatggatatgctgtatgggactccttttccagtgactccagg 107  Q
35709295 attaagaaccaaagataaacatcacatttgattattcatatataccaaactaggtttaaatggatatgctgtatgggactccttttccagtgactccagg 35709196  T
108 ccctgaaaatggctttaaagactcataaggcattatcccagctccatttctattcttcaaattcttgtttttattccttgagtctataataccttcaatc 207  Q
35709195 ccctgaaaatggctttaaagactcataaggcattatcccagctccatttctattcttcaaattcttgtttttattccttgagtctataataccttcaatc 35709096  T
208 tctttcaatctcctatgaaatctttcaaaagctgcttttatagttggattctcaccccaagatggctctattttttgtccaatatactcttcatctgctg 307  Q
35709095 tctttcaatctcctatgaaatctttcaaaagctgcttttatagttggattctcaccccaagatggctctattttttgtccaatatactcttcatctgctg 35708996  T
308 aatgctctgataatatgttcattataaccgtaaacaaggttgcttgaatttgtgatggaaagcactccaaaagtgtttgttctggtttgttaataaattt 407  Q
35708995 aatgctctgataatatgttcattataaccgtaaacaaggttgcttgaatttgtgatggaaagcactccaaaagtgtttgttctggtttgttaataaattt 35708896  T
408 ttcccattcttccttggtagggtcttctgttggcattttgtttcttgcaattgttggtctattaggaaaaaagcctatataagcatattgtgtgaagttc 507  Q
35708895 ttcccattcttccttggtagggtcttctgttggcattttgtttcttgcaattgttggtctattaggaaaaaagcctatataagcatattgtgtgaagttc 35708796  T
508 acagctgcatgatgagcagaggctatccaagttatagtagtgatgatatcagtaagatctttttgtgttttgagatttggccaccatggttcttcagatt 607  Q
35708795 acagctgcatgatgagcagaggctatccaagttatagtagtgatgatatcagtaagatctttttgtgttttgagatttggccaccatggttcttcagatt 35708696  T
608 tgtctgcatgtcccactgttcgaatttctgtccaccatgcttggagctcttgatcagactctacaatgctcgagcttggatagtaatgattgacataatc 707  Q
35708695 tgtctgcatgtcccactgttcgaatttctgtccaccatgcttggagctcttgatcagactctacaatgctcgagcttggatagtaatgattgacataatc 35708596  T
708 tgtcacccattgtttgattgcatcccatattagaagaccatcattggcaaaaaggtagtctt 769  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
35708595 tgtcacccattgtttgattgcatcccatattagaagaccatcattggcaaaagggtagtctt 35708534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 461; E-Value: 0
Query Start/End: Original strand, 50 - 769
Target Start/End: Complemental strand, 35725156 - 35724437
50 taccaaactaggtttaaatggatatgctgtatgggactccttttccagtgactccaggccctgaaaatggctttaaagactcataaggcattatcccagc 149  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||  || |||||    
35725156 taccacactaggtttaaatggatatgctgtatgggactccttttccagtgactccaggccctgaaaatggctttaaggactcataaggcacaataccagc 35725057  T
150 tccatttctattcttcaaattcttgtttttattccttgagtctataataccttcaatctctttcaatctcctatgaaatctttcaaaagctgcttttata 249  Q
    ||||| ||||||||||| |||| | | || ||||||||||||||||||||||||||| || ||||||||||| || ||  ||||||||||||| ||||||    
35725056 tccatgtctattcttcatattcctatcttcattccttgagtctataataccttcaatttcattcaatctcctttgtaacttttcaaaagctgcctttata 35724957  T
250 gttggattctcaccccaagatggctctattttttgtccaatatactcttcatctgctgaatgctctgataatatgttcattataaccgtaaacaaggttg 349  Q
    |||| |||||||||||||||||||||||||||||||||||| ||||||||||| | |||||| || ||||||||| |||| | || | |||| |||||||    
35724956 gttgaattctcaccccaagatggctctattttttgtccaatgtactcttcatcgggtgaatgttccgataatatgctcataacaatcataaataaggttg 35724857  T
350 cttgaatttgtgatggaaagcactccaaaagtgtttgttctggtttgttaataaatttttcccattcttccttggtagggtcttctgttggcattttgtt 449  Q
    ||||||||||||||||||| || |||||||||||||| ||||| | ||| ||||||||||||||||||||||| |||||||||||||| |||||||| ||    
35724856 cttgaatttgtgatggaaaacattccaaaagtgtttgctctggatggttcataaatttttcccattcttccttagtagggtcttctgtaggcattttctt 35724757  T
450 tcttgcaattgttggtctattaggaaaaaagcctatataagcatattgtgtgaagttcacagctgcatgatgagcagaggctatccaagttatagtagtg 549  Q
    ||| ||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||| |||||| |||||| ||     
35724756 tctagcaatggttggtctattagggaaaaagcctatataagcatattgtgtaaagttcacagctgaatgatgagcagatgctgtccaagctatagtggta 35724657  T
550 atgatatcagtaagatctttttgtgttttgagatttggccaccatggttcttcagatttgtctgcatgtcccactgttcgaatttctgtccaccatgctt 649  Q
    ||||| | | ||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
35724656 atgatgttaataagatcattttgtgttttgagatttggccaccatggttcttcagatttgtccgcatgtcccactgttcgaatttctgtccaccatgctt 35724557  T
650 ggagctcttgatcagactctacaatgctc-gagcttggatagtaatgattgacataatctgtcacccattgtttgattgcatcccatattagaagaccat 748  Q
    |||||||||||||||| |||| | | ||| |||||||||||||||||||||||||| ||||| ||||||||||| |||||||||||||||||||||||||    
35724556 ggagctcttgatcagattctatagt-ctctgagcttggatagtaatgattgacatattctgtgacccattgtttaattgcatcccatattagaagaccat 35724458  T
749 cattggcaaaaaggtagtctt 769  Q
    ||||||||||| |||||||||    
35724457 cattggcaaaagggtagtctt 35724437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 282; E-Value: 1e-157
Query Start/End: Original strand, 64 - 769
Target Start/End: Original strand, 35725585 - 35726290
64 taaatggatatgctgtatgggactccttttccagtgactccaggccctgaaaatggctttaaagactcataaggcattatcccagctccatttctattct 163  Q
    ||||| |||||||| ||||| ||||||||||||||||||||||| ||||||||||| || |    |||||| |||| ||||||||||||||| ||||| |    
35725585 taaatagatatgctatatggaactccttttccagtgactccaggtcctgaaaatggtttcattagctcatatggcactatcccagctccattcctatttt 35725684  T
164 tcaaattcttgtttttattccttgagtctataataccttcaatctctttcaatctcctatgaaatctttcaaaagctgcttttatagttggattctcacc 263  Q
    | |||||  | |||  ||| ||||||||||| ||| ||||||| || |||||||||| || ||| |||||||| ||| | ||||||| |||||||||| |    
35725685 tgaaattactatttgcatttcttgagtctattataacttcaatttccttcaatctcccattaaacctttcaaatgctacctttatagctggattctcagc 35725784  T
264 ccaagatggctctattttttgtccaatatactcttcatctgctgaatgctctgataatatgttcattataaccgtaaacaaggttgcttgaatttgtgat 363  Q
    ||| ||||| || ||   |||||| |  ||||||||||||| |||||| | |||||||| |||||  ||   | | |  ||||||||||||||||||||     
35725785 ccatgatggttcaatgagttgtcccaagtactcttcatctggtgaatgatatgataataagttcaaaatggtcatcactaaggttgcttgaatttgtgaa 35725884  T
364 ggaaagcactccaaaagtgtttgttctggtttgttaataaatttttcccattcttccttggtagggtcttctgttggcattttgtttcttgcaattgttg 463  Q
    || || ||||||||||||||||| || || ||||| | |||||| |||||||||||||| |||||||||||||| ||||| |||||||| ||||||||||    
35725885 gggaaacactccaaaagtgtttgctcaggcttgttcagaaatttctcccattcttcctttgtagggtcttctgtaggcatgttgtttctagcaattgttg 35725984  T
464 gtctattaggaaaaaagcctatataagcatattgtgtgaagttcacagctgcatgatgagcagaggctatccaagttatagtagtgatgatatcagtaag 563  Q
    |||||||||||||| |||||  |||||||||||||| ||||||    |||| |||||| ||||| |||| ||||| |||||| |||||||| ||| | ||    
35725985 gtctattaggaaaatagcctccataagcatattgtgcgaagtttgttgctgaatgatgtgcagatgctacccaagctatagtggtgatgatgtcaatgag 35726084  T
564 atctttttgtgttttgagatttggccaccatggttcttcagatttgtctgcatgtcccactgttcgaatttctgtccaccatgcttggagctcttgatca 663  Q
     |||||||||||||| ||||||||||||||||||||||| ||||||||  | || ||   |||||||| |||||||||||||||||| ||||||||||||    
35726085 gtctttttgtgttttcagatttggccaccatggttcttctgatttgtcgccgtggccttttgttcgaacttctgtccaccatgcttgaagctcttgatca 35726184  T
664 gactctacaatgctcgagcttggatagtaatgattgacataatctgtcacccattgtttgattgcatcccatattagaagaccatcattggcaaaaaggt 763  Q
    || ||||  ||||| |   ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||    
35726185 gattctatgatgcttggatttggatagtaatgattgacataatctgtcacccattgtttgattgcatcccatatgagaagaccatcattggcaaaagggt 35726284  T
764 agtctt 769  Q
35726285 agtctt 35726290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 713 - 753
Target Start/End: Original strand, 22512568 - 22512608
713 cccattgtttgattgcatcccatattagaagaccatcattg 753  Q
    |||||||||| ||||||||||||||| ||||||||||||||    
22512568 cccattgtttaattgcatcccatatttgaagaccatcattg 22512608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98590 times since January 2019
Visitors: 2275