View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-10 (Length: 577)

Name: F9164J-LTR4-TNT-insertion-10
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-10
F9164J-LTR4-TNT-insertion-10
[»] chr2 (44 HSPs)
chr2 (238-569)||(6843962-6844293)
chr2 (9-164)||(6843733-6843888)
chr2 (238-433)||(9660845-9661039)
chr2 (9-164)||(9661113-9661267)
chr2 (307-430)||(7317392-7317515)
chr2 (307-434)||(16143530-16143657)
chr2 (307-432)||(40304696-40304821)
chr2 (307-434)||(45492966-45493093)
chr2 (307-434)||(45500708-45500835)
chr2 (307-433)||(44097285-44097413)
chr2 (241-429)||(6842718-6842905)
chr2 (307-434)||(22053123-22053249)
chr2 (318-433)||(45499304-45499419)
chr2 (238-362)||(9662068-9662191)
chr2 (318-434)||(40303291-40303407)
chr2 (307-445)||(44095345-44095480)
chr2 (307-431)||(22060413-22060538)
chr2 (117-164)||(6842981-6843028)
chr2 (342-430)||(44465059-44465147)
chr2 (375-433)||(22054333-22054391)
chr2 (342-432)||(16142226-16142316)
chr2 (375-432)||(22060162-22060219)
chr2 (385-434)||(28165656-28165705)
chr2 (373-433)||(28563375-28563435)
chr2 (373-433)||(44906135-44906195)
chr2 (342-433)||(38730031-38730123)
chr2 (126-164)||(9661956-9661994)
chr2 (384-434)||(44492322-44492372)
chr2 (375-432)||(28563957-28564014)
chr2 (385-433)||(18224857-18224905)
chr2 (373-429)||(28167330-28167386)
chr2 (374-433)||(35588126-35588185)
chr2 (318-433)||(1840156-1840271)
chr2 (374-432)||(10343988-10344046)
chr2 (390-432)||(20587039-20587081)
chr2 (390-432)||(20588476-20588518)
chr2 (384-430)||(42928937-42928983)
chr2 (375-433)||(43516397-43516455)
chr2 (375-433)||(44820932-44820990)
chr2 (389-434)||(9662192-9662236)
chr2 (373-434)||(34591723-34591784)
chr2 (345-434)||(15346862-15346951)
chr2 (386-430)||(42827319-42827363)
chr2 (373-433)||(44421342-44421402)
[»] chr5 (14 HSPs)
chr5 (238-431)||(33083976-33084167)
chr5 (307-433)||(38626104-38626230)
chr5 (318-433)||(38624715-38624830)
chr5 (373-433)||(16308564-16308624)
chr5 (374-428)||(28592081-28592135)
chr5 (345-434)||(27756757-27756846)
chr5 (385-432)||(17555016-17555063)
chr5 (375-430)||(35931350-35931405)
chr5 (384-434)||(39103422-39103472)
chr5 (384-433)||(28592429-28592477)
chr5 (375-435)||(9672353-9672413)
chr5 (375-431)||(35929523-35929579)
chr5 (317-429)||(11771201-11771313)
chr5 (373-431)||(18201345-18201403)
[»] chr7 (35 HSPs)
chr7 (307-433)||(12178482-12178608)
chr7 (307-436)||(46246509-46246638)
chr7 (307-432)||(11669841-11669966)
chr7 (318-432)||(46245122-46245236)
chr7 (318-434)||(13420231-13420347)
chr7 (375-434)||(27161997-27162056)
chr7 (385-445)||(706730-706790)
chr7 (342-443)||(12180608-12180709)
chr7 (320-432)||(37348735-37348847)
chr7 (385-434)||(708164-708213)
chr7 (385-434)||(31734766-31734815)
chr7 (373-433)||(31393659-31393719)
chr7 (342-434)||(11671255-11671347)
chr7 (375-434)||(27160303-27160362)
chr7 (384-433)||(37133660-37133709)
chr7 (385-434)||(37547932-37547981)
chr7 (385-434)||(38758329-38758378)
chr7 (325-434)||(15136891-15137000)
chr7 (390-434)||(28848556-28848600)
chr7 (385-429)||(37350216-37350260)
chr7 (374-434)||(40030030-40030090)
chr7 (385-433)||(41384148-41384196)
chr7 (390-434)||(43546747-43546791)
chr7 (318-434)||(21716564-21716680)
chr7 (390-433)||(25008091-25008134)
chr7 (373-432)||(45277967-45278026)
chr7 (318-433)||(31392057-31392172)
chr7 (384-430)||(39787760-39787806)
chr7 (375-433)||(41591514-41591572)
chr7 (384-433)||(3704397-3704446)
chr7 (373-434)||(21715070-21715131)
chr7 (385-434)||(41385821-41385870)
chr7 (373-433)||(8230069-8230129)
chr7 (385-433)||(32429882-32429930)
chr7 (373-429)||(40028460-40028516)
[»] chr1 (47 HSPs)
chr1 (306-433)||(24437073-24437200)
chr1 (307-434)||(50315316-50315443)
chr1 (307-434)||(22684084-22684211)
chr1 (309-432)||(46604439-46604561)
chr1 (385-434)||(9419830-9419879)
chr1 (385-433)||(10708029-10708077)
chr1 (375-443)||(31815772-31815840)
chr1 (384-434)||(7184321-7184371)
chr1 (375-433)||(8323441-8323499)
chr1 (384-434)||(26734424-26734474)
chr1 (342-429)||(50317019-50317106)
chr1 (384-433)||(31028675-31028724)
chr1 (384-433)||(31035645-31035694)
chr1 (375-431)||(9626469-9626525)
chr1 (384-432)||(10612141-10612189)
chr1 (318-434)||(7655209-7655325)
chr1 (318-433)||(16673201-16673316)
chr1 (388-434)||(18604583-18604629)
chr1 (375-433)||(31809988-31810046)
chr1 (318-433)||(33257880-33257994)
chr1 (318-433)||(33278052-33278166)
chr1 (375-433)||(33753634-33753692)
chr1 (342-429)||(44268891-44268978)
chr1 (375-432)||(8322521-8322578)
chr1 (384-433)||(33755327-33755376)
chr1 (375-432)||(42301622-42301679)
chr1 (307-347)||(7384834-7384874)
chr1 (385-433)||(12095876-12095924)
chr1 (374-434)||(14095716-14095776)
chr1 (373-433)||(28360768-28360828)
chr1 (385-433)||(32847813-32847861)
chr1 (390-434)||(46652798-46652842)
chr1 (373-432)||(24438948-24439007)
chr1 (384-431)||(31027226-31027273)
chr1 (373-432)||(33259372-33259431)
chr1 (373-432)||(33279531-33279590)
chr1 (373-431)||(16592022-16592080)
chr1 (318-433)||(28919082-28919197)
chr1 (384-433)||(9627592-9627641)
chr1 (385-434)||(12097952-12098001)
chr1 (373-433)||(13229273-13229334)
chr1 (373-434)||(31321007-31321068)
chr1 (385-434)||(33981502-33981551)
chr1 (385-433)||(11431341-11431389)
chr1 (390-434)||(31034145-31034189)
chr1 (385-429)||(40767618-40767662)
chr1 (380-432)||(44269081-44269133)
[»] chr6 (15 HSPs)
chr6 (306-432)||(1443417-1443543)
chr6 (308-433)||(28048979-28049106)
chr6 (375-433)||(11065656-11065714)
chr6 (385-433)||(843533-843581)
chr6 (373-433)||(1256713-1256773)
chr6 (399-435)||(19402148-19402184)
chr6 (385-434)||(7796747-7796796)
chr6 (373-433)||(1258440-1258500)
chr6 (320-432)||(4496505-4496615)
chr6 (385-436)||(19597989-19598040)
chr6 (375-432)||(842186-842243)
chr6 (318-432)||(8745432-8745546)
chr6 (373-433)||(7678647-7678707)
chr6 (374-434)||(10707674-10707734)
chr6 (318-431)||(19084065-19084178)
[»] chr4 (39 HSPs)
chr4 (309-429)||(33607471-33607591)
chr4 (310-433)||(21354713-21354837)
chr4 (309-431)||(33609278-33609402)
chr4 (318-434)||(22307669-22307785)
chr4 (318-433)||(44251604-44251719)
chr4 (315-429)||(38157023-38157137)
chr4 (320-429)||(22309085-22309194)
chr4 (342-433)||(42978888-42978979)
chr4 (375-443)||(23703865-23703933)
chr4 (375-430)||(35786682-35786737)
chr4 (342-434)||(55948922-55949014)
chr4 (375-433)||(4906128-4906186)
chr4 (342-433)||(42889779-42889870)
chr4 (318-433)||(42977197-42977312)
chr4 (375-432)||(4931998-4932055)
chr4 (384-433)||(4933342-4933391)
chr4 (384-433)||(29756271-29756320)
chr4 (384-432)||(4907472-4907520)
chr4 (342-430)||(10337106-10337194)
chr4 (318-434)||(19994496-19994612)
chr4 (318-434)||(19995999-19996115)
chr4 (384-431)||(23702398-23702445)
chr4 (375-434)||(29757610-29757669)
chr4 (342-433)||(48713431-48713522)
chr4 (384-434)||(54534976-54535026)
chr4 (385-434)||(11148348-11148397)
chr4 (318-432)||(32082578-32082692)
chr4 (373-434)||(34538124-34538185)
chr4 (318-432)||(39654619-39654731)
chr4 (373-430)||(48711860-48711917)
chr4 (375-440)||(55019359-55019424)
chr4 (313-365)||(55017808-55017860)
chr4 (374-433)||(18597855-18597914)
chr4 (375-430)||(22674154-22674209)
chr4 (390-433)||(39929371-39929414)
chr4 (385-431)||(35785166-35785212)
chr4 (385-434)||(2671539-2671588)
chr4 (384-424)||(9561854-9561894)
chr4 (374-434)||(54123546-54123606)
[»] scaffold0280 (1 HSPs)
scaffold0280 (307-437)||(12126-12257)
[»] chr3 (31 HSPs)
chr3 (307-432)||(32613883-32614008)
chr3 (307-434)||(32558917-32559045)
chr3 (307-433)||(41081801-41081927)
chr3 (307-434)||(32559815-32559944)
chr3 (307-433)||(48566995-48567121)
chr3 (307-432)||(31795373-31795498)
chr3 (245-429)||(32615518-32615702)
chr3 (318-432)||(31796779-31796893)
chr3 (318-433)||(40499197-40499312)
chr3 (384-434)||(41083282-41083332)
chr3 (318-432)||(48568475-48568589)
chr3 (375-429)||(33781496-33781550)
chr3 (385-433)||(25529929-25529977)
chr3 (374-429)||(22942339-22942394)
chr3 (384-431)||(24612279-24612326)
chr3 (390-433)||(45981406-45981449)
chr3 (342-429)||(30700299-30700386)
chr3 (306-364)||(33552957-33553015)
chr3 (307-349)||(41881587-41881629)
chr3 (385-434)||(3150031-3150080)
chr3 (307-433)||(44458594-44458720)
chr3 (390-433)||(8391400-8391443)
chr3 (375-430)||(24613614-24613669)
chr3 (342-434)||(41879922-41880014)
chr3 (385-432)||(55196574-55196621)
chr3 (375-433)||(33780656-33780714)
chr3 (379-409)||(41881629-41881659)
chr3 (375-432)||(31199249-31199306)
chr3 (384-433)||(33732964-33733013)
chr3 (385-433)||(3026893-3026941)
chr3 (373-429)||(46725269-46725325)
[»] scaffold1176 (1 HSPs)
scaffold1176 (307-433)||(2050-2176)
[»] chr8 (23 HSPs)
chr8 (318-433)||(39884615-39884730)
chr8 (318-434)||(39886021-39886137)
chr8 (309-432)||(45448426-45448551)
chr8 (342-434)||(3158006-3158098)
chr8 (373-431)||(15279633-15279691)
chr8 (373-431)||(15460002-15460060)
chr8 (375-434)||(357975-358034)
chr8 (375-434)||(17706163-17706222)
chr8 (384-433)||(1650221-1650270)
chr8 (373-434)||(25264338-25264399)
chr8 (375-431)||(21142480-21142536)
chr8 (385-433)||(36899897-36899945)
chr8 (385-439)||(17707460-17707514)
chr8 (384-433)||(359325-359374)
chr8 (307-348)||(27339115-27339156)
chr8 (385-434)||(36901189-36901238)
chr8 (384-436)||(37963270-37963322)
chr8 (374-433)||(22714050-22714109)
chr8 (373-432)||(26719385-26719444)
chr8 (313-432)||(44690020-44690139)
chr8 (374-414)||(2552753-2552793)
chr8 (373-433)||(33293938-33293998)
chr8 (390-434)||(35506945-35506989)
[»] scaffold1118 (1 HSPs)
scaffold1118 (307-424)||(2420-2537)
[»] scaffold0129 (1 HSPs)
scaffold0129 (375-434)||(4259-4318)
[»] scaffold0060 (1 HSPs)
scaffold0060 (384-434)||(13262-13312)


Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-162; HSPs: 44)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-162
Query Start/End: Original strand, 238 - 569
Target Start/End: Original strand, 6843962 - 6844293
Alignment:
238 gtccctcaacgcgaactcaaccttcgccacatgtgtctttgtttgccagcaacgtgnnnnnnnaacagaaagttaacgttagggactaaaaccaaaaagc 337  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||    
6843962 gtccctcaacgcgaactcaaccttcgccacatgtgtctttgtttgccagcaacgtgtttttttaacagaaagttaacgttagggactaaaaccaaaaagc 6844061  T
338 taacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagat 437  Q
    ||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6844062 taacaacttacaaggtttgttttagaacaaaaaaagatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagat 6844161  T
438 aaaataaagaggccaaaaatatcgaaatttgatttactccatccaatatgagcaaggggtcagaatcacacattttaaatctaagatgccaaaattgtac 537  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6844162 aaaataaagaggccaaaaatatcgaaatttgatttactccatccaatatgagcaaggggtcagaatcacacattttaaatctaagatgccaaaattgtac 6844261  T
538 aattataaaacttgaggttataagtgcaatta 569  Q
    ||||||||||||||||||||||||||||||||    
6844262 aattataaaacttgaggttataagtgcaatta 6844293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 148; E-Value: 8e-78
Query Start/End: Original strand, 9 - 164
Target Start/End: Original strand, 6843733 - 6843888
Alignment:
9 agcgaggctaacaagtccctcagacaaagggtatgtaaaaaacacatcatcaatcatgttatagaaatcaacaaaaatatacgcgatcaaacaactgata 108  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
6843733 agcgaggctaacaagtctctcagacaaagggtatgtaaaaaacacatcatcaatcatgttatagaaatcaacaaaaatatacacgatcaaacaactgata 6843832  T
109 ttgtcattttagcaggtagatgaacaagagaaaacagagggatgaaaaagatatag 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6843833 ttgtcattttagcaggtagatgaacaagagaaaacagagggatgaaaaagatatag 6843888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 238 - 433
Target Start/End: Complemental strand, 9661039 - 9660845
Alignment:
238 gtccctcaacgcgaactcaaccttcgccacatgtgtctttgtttgccagcaacgtgnnnnnnnaacagaaagttaacgttagggactaaaaccaaaaagc 337  Q
    ||||||||||||||||||| ||||||||||||||||||| |||||||||||||| |       |||||||||||||||||||| ||||||||||||||||    
9661039 gtccctcaacgcgaactcagccttcgccacatgtgtcttcgtttgccagcaacgcgtttttttaacagaaagttaacgttaggaactaaaaccaaaaagc 9660940  T
338 taacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||| ||||| |||||||||       ||||||| |||||||||||||||||||||||||||| | ||||||||| ||||||||||||    
9660939 taacaacttacagggtttattttagaacaaaaaaagatacaacgatgaaaaccaaaaacacgcgaacttac-atgaccttttatatatttaagcct 9660845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 9 - 164
Target Start/End: Complemental strand, 9661267 - 9661113
Alignment:
9 agcgaggctaacaagtccctcagacaaagggtatgtaaaaaacacatcatcaatcatgttatagaaatcaacaaaaatatacgcgatcaaacaactgata 108  Q
    ||||||||||||||||| || ||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| | | ||||||||  |||    
9661267 agcgaggctaacaagtctcttagacaaaggatatgtaaaaaacacctcatcaatcatgttatagaaatcaacaaaaatatacac-accaaacaacatata 9661169  T
109 ttgtcattttagcaggtagatgaacaagagaaaacagagggatgaaaaagatatag 164  Q
    |||||| ||| ||||| ||||||||||||||||||||||||||||||| |||||||    
9661168 ttgtcactttggcaggcagatgaacaagagaaaacagagggatgaaaaggatatag 9661113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 307 - 430
Target Start/End: Complemental strand, 7317515 - 7317392
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||| |||||||| |||||||||||| |||||||||| | |||||||||||||||       |||||||||| |||||||||||||||||||||||    
7317515 aagttaacattagggaccaaaaccaaaaagttaacaacttatagggtttgttttagaacaaaaaaagatacaaggacgaaaaccaaaaacacgcgaactt 7317416  T
407 acaaggaccttttacatatttaag 430  Q
    ||| ||| ||||||||||||||||    
7317415 acagggatcttttacatatttaag 7317392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 307 - 434
Target Start/End: Original strand, 16143530 - 16143657
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||       |||||| ||| ||||| ||||||||||| | |||    
16143530 aagttaacgttagggactaaaaccaaaaagttaacaacttacagggtttgttttagaacaaaaaaagatacagggacgaaaatcaaaaacacgcaagctt 16143629  T
407 acaaggaccttttacatatttaagccta 434  Q
    ||  ||||||||||||||||||||||||    
16143630 acggggaccttttacatatttaagccta 16143657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 307 - 432
Target Start/End: Original strand, 40304696 - 40304821
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       |||||| ||| |||||||||||||||||||||||    
40304696 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaactt 40304795  T
407 acaaggaccttttacatatttaagcc 432  Q
    ||| ||||||||||||||||||||||    
40304796 acagggaccttttacatatttaagcc 40304821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 307 - 434
Target Start/End: Original strand, 45492966 - 45493093
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       |||||| ||| |||||||||||||||||||| ||    
45492966 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaattt 45493065  T
407 acaaggaccttttacatatttaagccta 434  Q
    ||| ||||||||||||||||||||||||    
45493066 acagggaccttttacatatttaagccta 45493093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 307 - 434
Target Start/End: Original strand, 45500708 - 45500835
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       |||||| ||| |||||||||||||||||||| ||    
45500708 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaattt 45500807  T
407 acaaggaccttttacatatttaagccta 434  Q
    ||| ||||||||||||||||||||||||    
45500808 acagggaccttttacatatttaagccta 45500835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 307 - 433
Target Start/End: Original strand, 44097285 - 44097413
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaa--cnnnnnnngatacaaggatgaaaaccaaaaacacgcgaac 404  Q
    |||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||           ||||| ||| |||||||||||||||||||||    
44097285 aagttaacgttagggactaaaaccaaaaggttaacaacttacagggtttgttttagaaggaaaaaaaaaatacagggacgaaaaccaaaaacacgcgaac 44097384  T
405 ttacaaggaccttttacatatttaagcct 433  Q
    |||||  ||||||||| ||||||||||||    
44097385 ttacagagaccttttatatatttaagcct 44097413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 241 - 429
Target Start/End: Complemental strand, 6842905 - 6842718
Alignment:
241 cctcaacgcgaactcaaccttcgccacatgtgtctttgtttgccagcaacgtgnnnnnnnaacagaaagttaacgttagggactaaaaccaaaaagctaa 340  Q
    ||||||||| |||||| |||||||||| ||||||| | |||| |||||||| |       ||||||| |||||||| | ||| ||||||||||||  |||    
6842905 cctcaacgccaactcagccttcgccacgtgtgtctctatttgtcagcaacgcgtttttttaacagaa-gttaacgtcaaggattaaaaccaaaaaattaa 6842807  T
341 caacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    ||||||||  | ||||||||| ||        |||||| ||||||||||||||||||||| |||||||| | |||||||||||||||||    
6842806 caacttaccggatttgttttaaaataaaaaaagatacagggatgaaaaccaaaaacacgcaaacttacaggaaccttttacatatttaa 6842718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 307 - 434
Target Start/End: Complemental strand, 22053249 - 22053123
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||||||||| | | | |||||||  |||| ||||||||||       |||||| ||| |||||| ||||||||||||||||    
22053249 aagttaacgttagggactaaaaccaaaacgtttataacttacggggtt-gttttagaacaaaaaaagatacagggacgaaaacaaaaaacacgcgaactt 22053151  T
407 acaaggaccttttacatatttaagccta 434  Q
    |||| |||||||||||||||||| ||||    
22053150 acaaagaccttttacatatttaaaccta 22053123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 45499419 - 45499304
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || ||||||||||||       |||||  ||| |||||||||||||||||||||||||| |||||||    
45499419 agggacgaaaatcaaaaagttattaacttacaggggttgttttagaacaaaaaaagatacggggacgaaaaccaaaaacacgcgaacttacagggacctt 45499320  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
45499319 ttacatatttaagcct 45499304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 238 - 362
Target Start/End: Original strand, 9662068 - 9662191
Alignment:
238 gtccctcaacgcgaactcaaccttcgccacatgtgtctttgtttgccagcaacgtgnnnnnnnaacagaaagttaacgttagggactaaaaccaaaaagc 337  Q
    |||||||||||| |||||| |||||||||| |||||||  |||||||||||||  |       ||||||| |||||||| ||||| ||||||||||||      
9662068 gtccctcaacgccaactcagccttcgccacgtgtgtctccgtttgccagcaacacgtttttttaacagaa-gttaacgtcagggattaaaaccaaaaaat 9662166  T
338 taacaacttacaaggtttgttttag 362  Q
    |||||||||||| ||||||||||||    
9662167 taacaacttacagggtttgttttag 9662191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 318 - 434
Target Start/End: Complemental strand, 40303407 - 40303291
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||  ||| |||||||||||||||||||||||||| |||||||    
40303407 agggacgaaaatcaaaaagttattaacttataggggttgttttagaacaaaaaaagatacggggacgaaaaccaaaaacacgcgaacttacagggacctt 40303308  T
418 ttacatatttaagccta 434  Q
    |||||||||||||||||    
40303307 ttacatatttaagccta 40303291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 307 - 445
Target Start/End: Complemental strand, 44095480 - 44095345
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||||||||| | |||||||||||| ||||||||||| ||         ||| || |||  |   | |||||||||||||||    
44095480 aagttaacgttagggactaaaaccaaaaggttaacaacttacagggtttgttttaaaa---aataaaataaaaagatacaggacgaaaacacgcgaactt 44095384  T
407 acaaggaccttttacatatttaagcctagataaaataaa 445  Q
    ||| ||||||||||||||||||||| || ||||||||||    
44095383 acatggaccttttacatatttaagcttaaataaaataaa 44095345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 307 - 431
Target Start/End: Original strand, 22060413 - 22060538
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnn-gatacaaggatgaaaaccaaaaacacgcgaact 405  Q
    |||||||||||||| ||||||||||||| ||| | ||||| || || |||||||| |||        |||| | ||| ||||||||||||||||| ||||    
22060413 aagttaacgttaggaactaaaaccaaaacgcttataactttcaggggttgttttaaaacaaaaaaaagatatagggacgaaaaccaaaaacacgcaaact 22060512  T
406 tacaaggaccttttacatatttaagc 431  Q
    |||| |||||||||||||||||||||    
22060513 tacagggaccttttacatatttaagc 22060538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 117 - 164
Target Start/End: Complemental strand, 6843028 - 6842981
Alignment:
117 ttagcaggtagatgaacaagagaaaacagagggatgaaaaagatatag 164  Q
    |||||||| ||||||||||||||||||||||||||||| |||||||||    
6843028 ttagcagggagatgaacaagagaaaacagagggatgaagaagatatag 6842981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 430
Target Start/End: Original strand, 44465059 - 44465147
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    |||||||||||| |||||||||||        ||||||||| || ||||||||||||||||||||||| ||||  ||||||||||||||    
44465059 aacttacaaggtctgttttagaacaacaaaaaatacaaggacgagaaccaaaaacacgcgaacttacagggacgatttacatatttaag 44465147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 22054391 - 22054333
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| ||||||||||||  |||||||||||| |||||||||||||||||||||||    
22054391 tacagggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcct 22054333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 342 - 432
Target Start/End: Complemental strand, 16142316 - 16142226
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||||| |||||||||||||||        |||||  || |||||||||||||||||||||||||||||||  ||||||||||| ||||    
16142316 aacttacagggtttgttttagaacagaaaaaaatacagagacgaaaaccaaaaacacgcgaacttacaaggacgatttacatattttagcc 16142226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 375 - 432
Target Start/End: Original strand, 22060162 - 22060219
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||| ||| ||||||||||||  |||||||||||| ||||||||||||||||||||||    
22060162 tacagggacgaaaaccaaaaatgcgcgaacttacatggaccttttacatatttaagcc 22060219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 28165705 - 28165656
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||| ||| |||||||| ||||||||||||||||||||||||    
28165705 aaaaccaaaaacgcgctaacttacatggaccttttacatatttaagccta 28165656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 28563435 - 28563375
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||| ||||||||||||||||| || ||||| ||||  |||||||||||||||||    
28563435 gatacaaggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaagcct 28563375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 44906135 - 44906195
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||| |||||||||||| ||| |||||| | ||||||||||| |||||||||||    
44906135 gatacaaggattaaaaccaaaaacgcgctaacttatagggaccttttacttatttaagcct 44906195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 342 - 433
Target Start/End: Original strand, 38730031 - 38730123
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatg-aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||| |||||||||||||||       |||||| ||| | |||||||||||||||||||||||||||||   |||| ||||||||||||    
38730031 aacttacagggtttgttttagaacaaaaaaagatacagggacgaaaaaccaaaaacacgcgaacttacaaggatgatttatatatttaagcct 38730123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 126 - 164
Target Start/End: Original strand, 9661956 - 9661994
Alignment:
126 agatgaacaagagaaaacagagggatgaaaaagatatag 164  Q
    ||||||||||||||||||||||||||||| |||||||||    
9661956 agatgaacaagagaaaacagagggatgaagaagatatag 9661994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 434
Target Start/End: Original strand, 44492322 - 44492372
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||||||||| |||||||| ||| | ||||||||||||||||||    
44492322 gaaaaccaaaaacacgcaaacttacatggatcgtttacatatttaagccta 44492372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 375 - 432
Target Start/End: Original strand, 28563957 - 28564014
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||| ||| ||||||||||| | |||||||||||||||||||||||| |||| |||||    
28563957 tacagggacgaaaaccaaaatctcgcgaacttacaaggaccttttacttattaaagcc 28564014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 18224857 - 18224905
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||| | || ||||| |||||||||||||||||||||||    
18224857 aaaaccaaaaacacactaaattacagggaccttttacatatttaagcct 18224905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 373 - 429
Target Start/End: Original strand, 28167330 - 28167386
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    ||||||||||  |||||||||||| ||| |||||||| ||||||||||| |||||||    
28167330 gatacaaggactaaaaccaaaaacgcgctaacttacagggaccttttacttatttaa 28167386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 374 - 433
Target Start/End: Complemental strand, 35588185 - 35588126
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||| ||| ||||||||||| |||||||||||||| ||||  ||| |||||||||||||    
35588185 atacatggacgaaaaccaaaagcacgcgaacttacatggacgatttccatatttaagcct 35588126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 1840271 - 1840156
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||||| |  |||||||||||||||| || ||||| ||||  |    
1840271 agggacgaaaatcaaaaagttattaacttataggggttgttttagaacaaaaaaagatacaagaacaaaaaccaaaaacacgccaaattacagggacgat 1840172  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
1840171 ttacatatttaagcct 1840156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 374 - 432
Target Start/End: Complemental strand, 10344046 - 10343988
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    ||||| ||| |||||| |||||  | |||||||||| ||||||||||||||||||||||    
10344046 atacagggacgaaaacaaaaaatgcacgaacttacatggaccttttacatatttaagcc 10343988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Complemental strand, 20587081 - 20587039
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||||||||||| ||||| |||| |||||||||||||||||    
20587081 caaaaacacgcgaaattacagggacgttttacatatttaagcc 20587039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 390 - 432
Target Start/End: Original strand, 20588476 - 20588518
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||||||||||| ||||| |||| |||||||||||||||||    
20588476 caaaaacacgcgaaattacagggacgttttacatatttaagcc 20588518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 384 - 430
Target Start/End: Complemental strand, 42928983 - 42928937
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    ||||||||||||  ||||||||||||  |||||||||||||||||||    
42928983 gaaaaccaaaaatgcgcgaacttacagagaccttttacatatttaag 42928937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 43516455 - 43516397
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| |||||| |||||  |||||| ||||| |||||||||||||||||||||||    
43516455 tacagggacgaaaacaaaaaatgcgcgaaattacagggaccttttacatatttaagcct 43516397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 375 - 433
Target Start/End: Original strand, 44820932 - 44820990
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| |||||| |||||  |||||| ||||| |||||||||||||||||||||||    
44820932 tacagggacgaaaacaaaaaatgcgcgaatttacagggaccttttacatatttaagcct 44820990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 389 - 434
Target Start/End: Original strand, 9662192 - 9662236
Alignment:
389 ccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||||||| || ||||| ||||||||||||||||||    
9662192 ccaaaaacacgcgaacttccagggacc-tttacatatttaagccta 9662236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 434
Target Start/End: Complemental strand, 34591784 - 34591723
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||| |||||| ||||| || | |||||||| ||||  ||||||||||||||||||    
34591784 gatacaaggacgaaaacaaaaaatacacaaacttacatggacgatttacatatttaagccta 34591723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 345 - 434
Target Start/End: Complemental strand, 15346951 - 15346862
Alignment:
345 ttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||| ||||||||||||       |||| | ||||||||||||||||||||| |||||||   |||  |||||||||||| |||||    
15346951 ttacaagggttgttttagaacaaaaaaagatatatggatgaaaaccaaaaacacgcaaacttactgagacaatttacatatttaggccta 15346862  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 386 - 430
Target Start/End: Complemental strand, 42827363 - 42827319
Alignment:
386 aaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    ||||||||||  |||||||||||||| ||| ||||||||||||||    
42827363 aaaccaaaaatgcgcgaacttacaagaaccgtttacatatttaag 42827319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 44421342 - 44421402
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||| |||||| |||||||||| || ||||| |||   |||||||||||||||||    
44421342 gatacaaggacgaaaacaaaaaacacgccaatttacagggatgatttacatatttaagcct 44421402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 79; Significance: 1e-36; HSPs: 14)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 238 - 431
Target Start/End: Original strand, 33083976 - 33084167
Alignment:
238 gtccctcaacgcgaactcaaccttcgccacatgtgtctttgtttgccagcaacgtgnnnnnnnaacagaaagttaacgttagggactaaaaccaaaaagc 337  Q
    ||||||||||||||||||| ||||||||||||| || || ||||||||||||||||       ||||||||||||||||||| |||||||||||||| ||    
33083976 gtccctcaacgcgaactcagccttcgccacatgcgttttcgtttgccagcaacgtgtttttt-aacagaaagttaacgttagtgactaaaaccaaaatgc 33084074  T
338 taacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    ||||||||||| |||||| |||||||||       |||||| ||||||||||||||||||| | ||||||||   || ||||| ||||||||||    
33084075 taacaacttac-aggtttattttagaacaaaaaaagatacagggatgaaaaccaaaaacacacaaacttacataaactttttatatatttaagc 33084167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 307 - 433
Target Start/End: Original strand, 38626104 - 38626230
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       |||||| ||| |||||||||||||| ||||||||    
38626104 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacatggacgaaaaccaaaaacatgcgaactt 38626203  T
407 acaaggaccttttacatatttaagcct 433  Q
    ||| |||||||||||||||||||||||    
38626204 acagggaccttttacatatttaagcct 38626230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 38624830 - 38624715
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||  ||| |||||||||||||||||||||||||| |||||||    
38624830 agggacgaaaatcaaaaagttattaacttataggggttgttttagaacaaaaaaagatacggggacgaaaaccaaaaacacgcgaacttacagggacctt 38624731  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
38624730 ttacatatttaagcct 38624715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 16308624 - 16308564
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| ||| |||||||||||||||||||||||||| ||||  |||||||||||||||||    
16308624 gatacagggacgaaaaccaaaaacacgcgaacttacagggacgatttacatatttaagcct 16308564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 374 - 428
Target Start/End: Complemental strand, 28592135 - 28592081
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatattta 428  Q
    ||||| ||| |||||  ||||||||||||||||||||||||||||||||||||||    
28592135 atacagggacgaaaataaaaaacacgcgaacttacaaggaccttttacatattta 28592081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 345 - 434
Target Start/End: Original strand, 27756757 - 27756846
Alignment:
345 ttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||| |||||||||||||||       |||||| ||| |||||| ||||||||||||||||| | ||||  ||||||||||||||||||    
27756757 ttacagggtttgttttagaacaaaaaaagatacagggacgaaaacaaaaaacacgcgaacttagagggacgatttacatatttaagccta 27756846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 385 - 432
Target Start/End: Original strand, 17555016 - 17555063
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    ||||||||||||||||||||||||| ||||  ||||||||||||||||    
17555016 aaaaccaaaaacacgcgaacttacatggacaatttacatatttaagcc 17555063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 375 - 430
Target Start/End: Original strand, 35931350 - 35931405
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    |||||||| ||||||||||| | |||||||||||| ||||||||||| ||||||||    
35931350 tacaaggacgaaaaccaaaatctcgcgaacttacagggaccttttacctatttaag 35931405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 434
Target Start/End: Original strand, 39103422 - 39103472
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||||||||| || ||||||||||  ||||||||||||||||||    
39103422 gaaaaccaaaaacacgccaaattacaaggacgatttacatatttaagccta 39103472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 28592429 - 28592477
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| |||||||||||||||||| ||||||| ||||||||||||||||    
28592429 gaaaacaaaaaacacgcgaacttac-aggacctcttacatatttaagcct 28592477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 375 - 435
Target Start/End: Original strand, 9672353 - 9672413
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctag 435  Q
    |||| ||| |||||| |||||  |||||||||||| |||||||||| ||||||||||||||    
9672353 tacagggacgaaaacaaaaaatgcgcgaacttacagggaccttttatatatttaagcctag 9672413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 375 - 431
Target Start/End: Complemental strand, 35929579 - 35929523
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    |||| ||| ||||||||||| | | |||||||||||||||||||||| |||||||||    
35929579 tacagggacgaaaaccaaaatctcacgaacttacaaggaccttttacttatttaagc 35929523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 317 - 429
Target Start/End: Complemental strand, 11771313 - 11771201
Alignment:
317 tagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacct 416  Q
    ||||||| |||  ||||||| || ||||||||| ||||||||||| ||        |||||| ||| ||||| ||||||||||| |||||||  | ||||    
11771313 tagggacgaaattcaaaaagttatcaacttacagggtttgttttaaaaaaaaaaaagatacagggacgaaaatcaaaaacacgcaaacttactcgaacct 11771214  T
417 tttacatatttaa 429  Q
    |||||||||||||    
11771213 tttacatatttaa 11771201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 373 - 431
Target Start/End: Original strand, 18201345 - 18201403
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    |||||||| | |||||| |||||||||| |||||||| ||||  |||||||||||||||    
18201345 gatacaagaacgaaaacaaaaaacacgcaaacttacagggacaatttacatatttaagc 18201403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 78; Significance: 5e-36; HSPs: 35)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 307 - 433
Target Start/End: Complemental strand, 12178608 - 12178482
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||||||||||| ||||||||||||  ||||||||||||||       |||||| ||| |||||||||||||||||||||||    
12178608 aagttaacgttagggactaaaaccaaaaagttaacaacttacagagtttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaactt 12178509  T
407 acaaggaccttttacatatttaagcct 433  Q
    | | |||||||||||||||||||||||    
12178508 agagggaccttttacatatttaagcct 12178482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 307 - 436
Target Start/End: Original strand, 46246509 - 46246638
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       |||||| ||| |||||||||||||||||||||||    
46246509 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaactt 46246608  T
407 acaaggaccttttacatatttaagcctaga 436  Q
    ||| ||||||||||||||||||||||||||    
46246609 acagggaccttttacatatttaagcctaga 46246638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 307 - 432
Target Start/End: Complemental strand, 11669966 - 11669841
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||| ||||| | |||||||||||| |||  ||||||||||         |||| ||| |||||||||||||| ||||||||    
11669966 aagttaacgttagggactaaaatcaaaaggttaacaacttacagggtgagttttagaacaaaaaaacttacatggacgaaaaccaaaaacatgcgaactt 11669867  T
407 acaaggaccttttacatatttaagcc 432  Q
    ||| ||||| ||||||||||||||||    
11669866 acagggaccgtttacatatttaagcc 11669841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 432
Target Start/End: Complemental strand, 46245236 - 46245122
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || ||||||||||||       |||||  ||| |||||||||||||||||||||||||| |||||||    
46245236 agggacgaaaatcaaaaagttattaacttacaggggttgttttagaacaaaaaaagatacggggacgaaaaccaaaaacacgcgaacttacagggacctt 46245137  T
418 ttacatatttaagcc 432  Q
    |||||||||||||||    
46245136 ttacatatttaagcc 46245122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 318 - 434
Target Start/End: Original strand, 13420231 - 13420347
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    ||||||||||||||||| ||| | |||||||| || ||||||||||||       |||||| |||  |||||||||||||||| |||||||| || || |    
13420231 agggactaaaaccaaaatgcttataacttacaggggttgttttagaacaaaaaaagatacagggactaaaaccaaaaacacgcaaacttacaggggccat 13420330  T
418 ttacatatttaagccta 434  Q
    |||||||||||||||||    
13420331 ttacatatttaagccta 13420347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 375 - 434
Target Start/End: Original strand, 27161997 - 27162056
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||| ||||||||||| | |||||||||||| ||||||||||||||||||||||||    
27161997 tacaaggacgaaaaccaaaatctcgcgaacttacagggaccttttacatatttaagccta 27162056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 385 - 445
Target Start/End: Complemental strand, 706790 - 706730
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagataaaataaa 445  Q
    |||||||||||||||| || ||||| |||||||||||||||||||||||| |||| |||||    
706790 aaaaccaaaaacacgctaaattacagggaccttttacatatttaagcctatataatataaa 706730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 342 - 443
Target Start/End: Original strand, 12180608 - 12180709
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagataaaa 441  Q
    |||||||| |||||||||||||||       |||||| ||| |||||||||||||||||||||||||| ||||  || |||||||| |||||| | ||||    
12180608 aacttacagggtttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaacttacagggacaattaacatattttagcctaaaaaaaa 12180707  T
442 ta 443  Q
    ||    
12180708 ta 12180709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 320 - 432
Target Start/End: Complemental strand, 37348847 - 37348735
Alignment:
320 ggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctttt 419  Q
    ||||||||||||||| | | | ||||||||||| ||||||||||||       |||| | |||  ||||||||||||||||||||||||  ||||| |||    
37348847 ggactaaaaccaaaacgtttataacttacaaggattgttttagaacaaaaaatgatatagggactaaaaccaaaaacacgcgaacttacggggaccattt 37348748  T
420 acatatttaagcc 432  Q
    ||| |||||||||    
37348747 acaaatttaagcc 37348735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 708164 - 708213
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||||| || ||||| ||||||||||||||||||||||||    
708164 aaaaccaaaaacacgctaaattacagggaccttttacatatttaagccta 708213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 31734766 - 31734815
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||||||||||||||||||||||  ||||||| ||||||||||    
31734766 aaaaccaaaaacacgcgaacttacaaggacgatttacatgtttaagccta 31734815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 31393659 - 31393719
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||| ||||||||||||||||| || ||||| ||||  |||||||||||||||||    
31393659 gatacaaggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaagcct 31393719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 342 - 434
Target Start/End: Original strand, 11671255 - 11671347
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||| |||||||||||||||       |||||| ||| |||||| ||||||||||||||||||  ||||  ||||||||||||| ||||    
11671255 aacttacagggtttgttttagaacaaaaatagatacatggacgaaaacaaaaaacacgcgaacttacggggacgatttacatatttaaaccta 11671347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 375 - 434
Target Start/End: Complemental strand, 27160362 - 27160303
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||| ||| ||||||||||| | | |||||||||||||||||||||| ||||||||||||    
27160362 tacagggacgaaaaccaaaatctcacgaacttacaaggaccttttacttatttaagccta 27160303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 37133660 - 37133709
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||||||||||||||  ||||  |||||||||||||||||    
37133660 gaaaaccaaaaacacgcgaacttacggggacgatttacatatttaagcct 37133709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 37547981 - 37547932
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||| | | |||||||||||||||||||| ||||||||||||    
37547981 aaaaccaaaaacgcaccaacttacaaggaccttttacttatttaagccta 37547932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 38758329 - 38758378
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||| ||| |||||||| ||||||||||| ||||||||||||    
38758329 aaaaccaaaaacgcgctaacttacagggaccttttacttatttaagccta 38758378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 325 - 434
Target Start/End: Original strand, 15136891 - 15137000
Alignment:
325 aaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacata 424  Q
    |||| ||||||| ||  ||||| ||||| ||||||||||||       ||| |||||| ||||| |||||||||||||| ||||| ||||  |||| |||    
15136891 aaaatcaaaaagttattaacttgcaagggttgttttagaacaaaaaaagattcaaggacgaaaatcaaaaacacgcgaatttacagggacgatttatata 15136990  T
425 tttaagccta 434  Q
    ||||||||||    
15136991 tttaagccta 15137000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 390 - 434
Target Start/End: Complemental strand, 28848600 - 28848556
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||| ||||| |||| |||||||||||||||||||    
28848600 caaaaacacgcgaaattacagggacgttttacatatttaagccta 28848556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 429
Target Start/End: Original strand, 37350216 - 37350260
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    ||||||||||||||||||||||||  ||||| |||||||||||||    
37350216 aaaaccaaaaacacgcgaacttacggggaccatttacatatttaa 37350260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 374 - 434
Target Start/End: Original strand, 40030030 - 40030090
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||| |||||||||| |||||||||| || ||||| ||||  ||||||||||||||||||    
40030030 atacagggatgaaaacaaaaaacacgccaaattacagggacgatttacatatttaagccta 40030090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 41384196 - 41384148
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||| |||||  |||||||||||||||||| |||||||||||||||||    
41384196 aaaacaaaaaatgcgcgaacttacaaggaccatttacatatttaagcct 41384148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 390 - 434
Target Start/End: Original strand, 43546747 - 43546791
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||| ||||| |||| |||||||||||||||||||    
43546747 caaaaacacgcgaaattacagggacgttttacatatttaagccta 43546791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 318 - 434
Target Start/End: Original strand, 21716564 - 21716680
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || |||||||| |||       |||||| ||| ||||||||||||||||| || ||||| | ||  |    
21716564 agggacgaaaatcaaaaagttattaacttacagggattgttttaaaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacaggaacgat 21716663  T
418 ttacatatttaagccta 434  Q
    |||||||||||||||||    
21716664 ttacatatttaagccta 21716680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 390 - 433
Target Start/End: Complemental strand, 25008134 - 25008091
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||| ||||| |||| ||||||||||||||||||    
25008134 caaaaacacgcgaaattacagggacgttttacatatttaagcct 25008091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 432
Target Start/End: Original strand, 45277967 - 45278026
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||| ||| ||||||||||||||||| || ||||| ||||  ||||||||||||||||    
45277967 gatacagggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaagcc 45278026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 31392172 - 31392057
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||| ||| ||||||||||||||||  || ||||| ||||  |    
31392172 agggacgaaaatcaaaaagttattaacttataggggttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgtcaaattacagggacgat 31392073  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
31392072 ttacatatttaagcct 31392057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 384 - 430
Target Start/End: Complemental strand, 39787806 - 39787760
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    ||||| ||||||||||| |||||||| |||||| |||||||||||||    
39787806 gaaaagcaaaaacacgcaaacttacatggacctcttacatatttaag 39787760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 41591572 - 41591514
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| |||||| |||||  |||||| ||||| |||||||||||||||||||||||    
41591572 tacagggacgaaaacaaaaaatgcgcgaaattacagggaccttttacatatttaagcct 41591514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 3704446 - 3704397
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||| ||||||||||| ||||  ||||| |||||||||||    
3704446 gaaaaccaaaaacaagcgaacttacatggacgatttacctatttaagcct 3704397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 434
Target Start/End: Complemental strand, 21715131 - 21715070
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||| ||| ||||| ||||||||||| || ||||| ||||  ||||||||||||||||||    
21715131 gatacagggacgaaaatcaaaaacacgccaaattacagggacgatttacatatttaagccta 21715070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 41385821 - 41385870
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||| |||||  |||||||||||| ||||| ||||||||||||||||||    
41385821 aaaacaaaaaatgcgcgaacttacagggaccatttacatatttaagccta 41385870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 8230129 - 8230069
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| ||| ||||||||||||||| | || ||||| ||||  |||||||||||||||||    
8230129 gatacagggacgaaaaccaaaaacacaccaaattacagggacgatttacatatttaagcct 8230069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 32429882 - 32429930
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||| ||| |||||||| |||| |||||| |||||||||||    
32429882 aaaaccaaaaacgcgccaacttacagggactttttacttatttaagcct 32429930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 373 - 429
Target Start/End: Complemental strand, 40028516 - 40028460
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    |||||| ||| ||||||||||||||||| || ||||| ||||  |||||||||||||    
40028516 gatacagggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaa 40028460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 75; Significance: 3e-34; HSPs: 47)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 306 - 433
Target Start/End: Complemental strand, 24437200 - 24437073
Alignment:
306 aaagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaact 405  Q
    ||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||       ||||||  || |||||| |||||||||||||||    
24437200 aaagttaacgttagggactaaaaccaaaaagttaacaatttacagggtttgttttagaacaaaaaaagatacagtgacgaaaacaaaaaacacgcgaact 24437101  T
406 tacaaggaccttttacatatttaagcct 433  Q
    |||| |||||||||||||||||||||||    
24437100 tacagggaccttttacatatttaagcct 24437073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 307 - 434
Target Start/End: Complemental strand, 50315443 - 50315316
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||||||||| | |||||||||||| |||  ||||||||||         ||||  || |||||||||||||||||||||||    
50315443 aagttaacgttagggactaaaaccaaaaggttaacaacttacagggtgagttttagaacaaaaaaacttacagagacgaaaaccaaaaacacgcgaactt 50315344  T
407 acaaggaccttttacatatttaagccta 434  Q
    ||| ||||||||||||||||||||||||    
50315343 acagggaccttttacatatttaagccta 50315316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 307 - 434
Target Start/End: Original strand, 22684084 - 22684211
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||| ||||| |||||||||||||||       |||||| ||| |||||||||||||||||||||||    
22684084 aagttgacggtagggacgaaattcaaaaagttatcaatttacagggtttgttttagaacaaaaaaagatacatggacgaaaaccaaaaacacgcgaactt 22684183  T
407 acaaggaccttttacatatttaagccta 434  Q
    |||||||||||||||||||| |||||||    
22684184 acaaggaccttttacatattaaagccta 22684211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 309 - 432
Target Start/End: Complemental strand, 46604561 - 46604439
Alignment:
309 gttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttac 408  Q
    |||||||||||||||||||||||||| | | |||||||||| ||||||| ||||||         ||||||||| ||||||||||||||||| |||||||    
46604561 gttaacgttagggactaaaaccaaaatgttcacaacttacagggtttgtgttagaaaaaaaaaa-atacaaggacgaaaaccaaaaacacgcaaacttac 46604463  T
409 aaggaccttttacatatttaagcc 432  Q
    | ||||||||||||||||||||||    
46604462 agggaccttttacatatttaagcc 46604439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 9419830 - 9419879
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||    
9419830 aaaagcaaaaacacgccaacttacaaggaccttttacatatttaagccta 9419879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 10708077 - 10708029
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||||||||||||||||| |||| ||||||||||||||||||    
10708077 aaaaccaaaaacacgcgaacttacagggactttttacatatttaagcct 10708029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 375 - 443
Target Start/End: Original strand, 31815772 - 31815840
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagataaaata 443  Q
    |||| ||| ||||||||||||  |||||||||||| |||||||||||||||||||||||  ||||||||    
31815772 tacagggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagccttaataaaata 31815840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 7184371 - 7184321
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||||||||||||||||| ||  ||||||||||||||||||    
7184371 gaaaaccaaaaacacgcgaacttacaagaacaatttacatatttaagccta 7184321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 375 - 433
Target Start/End: Original strand, 8323441 - 8323499
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| ||||||||||||  |||||||||||| |||||||||||||||||||||||    
8323441 tacagggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcct 8323499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 26734474 - 26734424
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||||  |||||||||||| ||||||||||||||||||||||||    
26734474 gaaaaccaaaaatgcgcgaacttacatggaccttttacatatttaagccta 26734424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 342 - 429
Target Start/End: Original strand, 50317019 - 50317106
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    |||||||| |||||||||||||||       |||||| ||| ||||| |||||||||||||||||||| ||||  |||||||||||||    
50317019 aacttacagggtttgttttagaacaaaaaaagatacagggacgaaaatcaaaaacacgcgaacttacatggacgatttacatatttaa 50317106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 31028675 - 31028724
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||| |||||||||||||||||| |||||||||||| ||||||||||||    
31028675 gaaaagcaaaaacacgcgaacttataaggaccttttatatatttaagcct 31028724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 31035645 - 31035694
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||| |||||||||||||||||| |||||||||||| ||||||||||||    
31035645 gaaaagcaaaaacacgcgaacttataaggaccttttatatatttaagcct 31035694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 375 - 431
Target Start/End: Complemental strand, 9626525 - 9626469
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    |||| ||| |||||| ||||| ||||||||||||| |||||||||||||||||||||    
9626525 tacagggacgaaaacaaaaaatacgcgaacttacagggaccttttacatatttaagc 9626469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 432
Target Start/End: Original strand, 10612141 - 10612189
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    ||||| ||||||||| |||||||| ||||||||||||||||||||||||    
10612141 gaaaagcaaaaacacacgaacttataaggaccttttacatatttaagcc 10612189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 318 - 434
Target Start/End: Original strand, 7655209 - 7655325
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || ||||||||||||       |||||| ||| ||||||||||||||||| || ||||| | ||  |    
7655209 agggacgaaaatcaaaaagttattaacttacaggggttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacaggaacgat 7655308  T
418 ttacatatttaagccta 434  Q
    |||||||||||||||||    
7655309 ttacatatttaagccta 7655325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 433
Target Start/End: Original strand, 16673201 - 16673316
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||| ||| ||||||||||||||||| || ||||| ||||  |    
16673201 agggacgaaaatcaaaaagttattaacttataggggttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcaaaattacagggacgat 16673300  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
16673301 ttacatatttaagcct 16673316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 388 - 434
Target Start/End: Original strand, 18604583 - 18604629
Alignment:
388 accaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||| |||||||||||||| ||| ||||||||||||||||||||    
18604583 accaaaagcacgcgaacttacagggatcttttacatatttaagccta 18604629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 31810046 - 31809988
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| |||||| |||||  |||||||||||| |||||||||||||||||||||||    
31810046 tacagggacgaaaacaaaaaatgcgcgaacttacagggaccttttacatatttaagcct 31809988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 33257994 - 33257880
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| |||| ||||||||||       ||||||||||  |||||||||||||||| || ||||| ||||  |    
33257994 agggacgaaaatcaaaaagttattaacttacagggtt-gttttagaacaaaaaaagatacaaggacaaaaaccaaaaacacgccaaattacagggacgat 33257896  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
33257895 ttacatatttaagcct 33257880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 33278166 - 33278052
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| |||| ||||||||||       ||||||||||  |||||||||||||||| || ||||| ||||  |    
33278166 agggacgaaaatcaaaaagttattaacttacagggtt-gttttagaacaaaaaaagatacaaggacaaaaaccaaaaacacgccaaattacagggacgat 33278068  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
33278067 ttacatatttaagcct 33278052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 33753692 - 33753634
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||| ||||||||||| | |||||||||||| ||||||||||| ||| |||||||    
33753692 tacaaggacgaaaaccaaaatctcgcgaacttacagggaccttttacctatgtaagcct 33753634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 429
Target Start/End: Complemental strand, 44268978 - 44268891
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    |||||||| ||| |||||||||||       ||||||  ||| ||||||||||||||||||||||||| ||||  |||||||||||||    
44268978 aacttacatggtctgttttagaacaaaaaaagatacagagataaaaaccaaaaacacgcgaacttacagggacgatttacatatttaa 44268891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 375 - 432
Target Start/End: Complemental strand, 8322578 - 8322521
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||| ||| |||||| |||||  |||||||||||| ||||||||||||||||||||||    
8322578 tacagggacgaaaacaaaaaatgcgcgaacttacagggaccttttacatatttaagcc 8322521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 33755327 - 33755376
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||| | | |||||||||||||||||||||| |||||||||||    
33755327 gaaaaccaaaatctcacgaacttacaaggaccttttacttatttaagcct 33755376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 375 - 432
Target Start/End: Original strand, 42301622 - 42301679
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||||| |||||| ||||| ||||||||||| | | ||||||||||||||||||||    
42301622 tacaaggacgaaaacaaaaaatacgcgaacttagaggaaccttttacatatttaagcc 42301679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 307 - 347
Target Start/End: Original strand, 7384834 - 7384874
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaactta 347  Q
    ||||| ||||||||||| |||||||||||||||||||||||    
7384834 aagttgacgttagggaccaaaaccaaaaagctaacaactta 7384874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 12095924 - 12095876
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||| | |||||||||| ||||||||||| |||||||||||    
12095924 aaaaccaaaaacgcacgaacttacagggaccttttacttatttaagcct 12095876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 374 - 434
Target Start/End: Complemental strand, 14095776 - 14095716
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||| ||| |||||  ||||||||||||||||||| | ||||||||||||||||| ||||    
14095776 atacatggacgaaaataaaaaacacgcgaacttacatgaaccttttacatatttaaaccta 14095716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 28360828 - 28360768
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||  ||||||||||   ||| ||||||||||||||||| ||||||||||||||    
28360828 gatacaaggactaaaaccaaaagtgcgccaacttacaaggacctttaacatatttaagcct 28360768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 32847861 - 32847813
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||| ||| |||||||| ||||||||||| |||||||||||    
32847861 aaaaccaaaaacgcgccaacttacagggaccttttacttatttaagcct 32847813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 390 - 434
Target Start/End: Original strand, 46652798 - 46652842
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||| ||||| |||| |||||||||||||||||||    
46652798 caaaaacacgcgaaattacagggacgttttacatatttaagccta 46652842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 432
Target Start/End: Original strand, 24438948 - 24439007
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||| ||| |||||||||||||||||||| ||||| ||||  ||||||||||| ||||    
24438948 gatacagggacgaaaaccaaaaacacgcgaatttacagggacgatttacatattttagcc 24439007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 384 - 431
Target Start/End: Complemental strand, 31027273 - 31027226
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    ||||| ||||||||  |||||||||| |||||||||||||||||||||    
31027273 gaaaagcaaaaacatacgaacttacatggaccttttacatatttaagc 31027226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 432
Target Start/End: Original strand, 33259372 - 33259431
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||| ||| ||||||||||||||||| || ||||| ||||  ||||||||||||||||    
33259372 gatacagggacgaaaaccaaaaacacgccaaattacagggacaatttacatatttaagcc 33259431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 432
Target Start/End: Original strand, 33279531 - 33279590
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||| ||| ||||||||||||||||| || ||||| ||||  ||||||||||||||||    
33279531 gatacagggacgaaaaccaaaaacacgccaaattacagggacaatttacatatttaagcc 33279590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 373 - 431
Target Start/End: Complemental strand, 16592080 - 16592022
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    |||||| ||| ||||||||||||||||| || ||||| ||||  |||||||||||||||    
16592080 gatacagggacgaaaaccaaaaacacgccaaattacagggacaatttacatatttaagc 16592022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 28919197 - 28919082
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||| ||||||||| ||||||||||| || ||||| ||||  |    
28919197 agggacgaaaatcaaaaagttattaacttataggggttgttttagaacaaaaaaagatacagggatgaaaatcaaaaacacgccaaattacagggacaat 28919098  T
418 ttacatatttaagcct 433  Q
    ||| ||||||||||||    
28919097 ttatatatttaagcct 28919082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 9627592 - 9627641
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| |||||  ||||||||||||  ||||||||||||||||||||||    
9627592 gaaaacaaaaaatgcgcgaacttacagagaccttttacatatttaagcct 9627641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 12097952 - 12098001
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||  |||||||||||  ||||||||||| ||||||||||||    
12097952 aaaaccaaaaatgcgcgaacttacggggaccttttacttatttaagccta 12098001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 13229273 - 13229334
Alignment:
373 gatacaaggatgaaaaccaaaaa-cacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| |||| ||||||||||| | ||| |||||||| ||||||||| |||||||||||||    
13229273 gatacagggattaaaaccaaaaaacgcgctaacttacagggaccttttgcatatttaagcct 13229334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 373 - 434
Target Start/End: Complemental strand, 31321068 - 31321007
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||| ||| |||||||||||||||||||||||||| |||   ||||  ||||||||||||    
31321068 gatacagggacgaaaaccaaaaacacgcgaacttacagggatgatttaactatttaagccta 31321007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 33981551 - 33981502
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||| |||||||| | ||||  ||||||||||||||||||    
33981551 aaaaccaaaaacacacgaacttatagggacgatttacatatttaagccta 33981502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 11431341 - 11431389
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||| |||||| ||| |||||||| ||||||||||| |||||||||||    
11431341 aaaacgaaaaacgcgccaacttacagggaccttttacttatttaagcct 11431389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 390 - 434
Target Start/End: Complemental strand, 31034189 - 31034145
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||  |||||||||| |||| |||||||||||||||||||    
31034189 caaaaacatacgaacttacatggactttttacatatttaagccta 31034145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 385 - 429
Target Start/End: Complemental strand, 40767662 - 40767618
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    |||||||||||| ||| ||||||||  ||||||||||||||||||    
40767662 aaaaccaaaaacgcgcaaacttacagagaccttttacatatttaa 40767618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 380 - 432
Target Start/End: Original strand, 44269081 - 44269133
Alignment:
380 ggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    ||||||||| |||||||||||||| |||||  |||  ||||||||||||||||    
44269081 ggatgaaaatcaaaaacacgcgaatttacagagacgatttacatatttaagcc 44269133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 70; Significance: 3e-31; HSPs: 15)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 306 - 432
Target Start/End: Complemental strand, 1443543 - 1443417
Alignment:
306 aaagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaact 405  Q
    ||||||||||||||||||||||||||||||| |||||||||||  |||||||||||||||        ||||| ||| |||||||||||||||| |||||    
1443543 aaagttaacgttagggactaaaaccaaaaagttaacaacttaccgggtttgttttagaacaaaaaaaaatacagggacgaaaaccaaaaacacgtgaact 1443444  T
406 tacaaggaccttttacatatttaagcc 432  Q
    |||| |||||||| |||||||||||||    
1443443 tacagggacctttcacatatttaagcc 1443417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 308 - 433
Target Start/End: Complemental strand, 28049106 - 28048979
Alignment:
308 agttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaag--gatgaaaaccaaaaacacgcgaact 405  Q
    ||||||||||||||||||||||||||| | |||||||||||| |||| ||||||||||         ||||||  ||  |||||||||||||||||||||    
28049106 agttaacgttagggactaaaaccaaaaggttaacaacttacagggttagttttagaacaaaaaaacttacaagcagacaaaaaccaaaaacacgcgaact 28049007  T
406 tacaaggaccttttacatatttaagcct 433  Q
    ||||  ||||||| | ||||||||||||    
28049006 tacagagacctttgatatatttaagcct 28048979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 375 - 433
Target Start/End: Original strand, 11065656 - 11065714
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| ||||||||||||  ||||||||||||||||||||||||||||||||||||    
11065656 tacagggacgaaaaccaaaaatgcgcgaacttacaaggaccttttacatatttaagcct 11065714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 843533 - 843581
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||  |||||||||||| |||||||||||||||||||||||    
843533 aaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcct 843581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 1256773 - 1256713
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| ||| ||||||||||||||||| || ||||||||||  |||||||||||||||||    
1256773 gatacagggacgaaaaccaaaaacacgccaaattacaaggacgatttacatatttaagcct 1256713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 399 - 435
Target Start/End: Original strand, 19402148 - 19402184
Alignment:
399 gcgaacttacaaggaccttttacatatttaagcctag 435  Q
    |||||||||||||||||||||||||||||||||||||    
19402148 gcgaacttacaaggaccttttacatatttaagcctag 19402184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 7796796 - 7796747
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||  |||||||||||  ||||||||||||||||||||||||    
7796796 aaaaccaaaaatgcgcgaacttactgggaccttttacatatttaagccta 7796747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 1258440 - 1258500
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| ||| ||||||||||||||||| || ||||| ||||  |||||||||||||||||    
1258440 gatacagggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaagcct 1258500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 320 - 432
Target Start/End: Complemental strand, 4496615 - 4496505
Alignment:
320 ggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctttt 419  Q
    |||| |||||||||| | | | |||||||| |||||||||||||||        ||||| ||| |||||||||||||||| |||||||||| |||  |||    
4496615 ggaccaaaaccaaaacgatgataacttacatggtttgttttagaacaaatta--atacatggacgaaaaccaaaaacacgtgaacttacaatgacgattt 4496518  T
420 acatatttaagcc 432  Q
    || ||||||||||    
4496517 acctatttaagcc 4496505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 436
Target Start/End: Original strand, 19597989 - 19598040
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctaga 436  Q
    |||||||||||  |||| ||||||| ||||| ||||||||||||||||||||    
19597989 aaaaccaaaaatgcgcggacttacagggaccatttacatatttaagcctaga 19598040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 375 - 432
Target Start/End: Complemental strand, 842243 - 842186
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||| ||| |||||| |||||  |||||||||||| ||||||| ||||||||||||||    
842243 tacagggacgaaaacaaaaaatgcgcgaacttacagggaccttatacatatttaagcc 842186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 318 - 432
Target Start/End: Complemental strand, 8745546 - 8745432
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||  || ||||||||||||       |||| | ||| ||||||||||||||||| || ||||| ||||  |    
8745546 agggacgaaaagcaaaaagttattaacttacgggggttgttttagaacaaaaaaagatatagggacgaaaaccaaaaacacgccaaattacagggacgat 8745447  T
418 ttacatatttaagcc 432  Q
    |||||||||||||||    
8745446 ttacatatttaagcc 8745432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 373 - 433
Target Start/End: Original strand, 7678647 - 7678707
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||  |||| ||||||||||| || ||||| ||||  |||||||||||||||||    
7678647 gatacaaggacaaaaagcaaaaacacgccaaattacagggacgatttacatatttaagcct 7678707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 374 - 434
Target Start/End: Complemental strand, 10707734 - 10707674
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||| ||| |||||  ||||||||||||||||||| ||||  |||| |||||||||||||    
10707734 atacagggacgaaaataaaaaacacgcgaacttacagggacaatttatatatttaagccta 10707674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 318 - 431
Target Start/End: Original strand, 19084065 - 19084178
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  ||| |||| || ||||||||||||       |||||| |||  |||||||||||||||| || ||||| ||||  |    
19084065 agggacgaaaatcaaaaagttattaacatacaggggttgttttagaacaaaaaaagatacagggacaaaaaccaaaaacacgctaaattacagggacggt 19084164  T
418 ttacatatttaagc 431  Q
    ||||||||||||||    
19084165 ttacatatttaagc 19084178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 68; Significance: 4e-30; HSPs: 39)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 309 - 429
Target Start/End: Complemental strand, 33607591 - 33607471
Alignment:
309 gttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttac 408  Q
    |||||||||||||||||||||||||| | | |||||||||| ||||||||||||||        |||||||||| |||||||||||||||||||||||||    
33607591 gttaacgttagggactaaaaccaaaatgtttacaacttacagggtttgttttagaaaaaaaaaagatacaaggacgaaaaccaaaaacacgcgaacttac 33607492  T
409 aaggaccttttacatatttaa 429  Q
    |  ||||||||||||||||||    
33607491 agagaccttttacatatttaa 33607471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 310 - 433
Target Start/End: Original strand, 21354713 - 21354837
Alignment:
310 ttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcg-aacttac 408  Q
    ||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||       |||||| ||| ||||| |||||||||||| |||||||    
21354713 ttaacgttaaggactaaaaccaaaaagttaacaacttacagggtttgttttagaacaaaaaaagatacagggacgaaaatcaaaaacacgcgaaacttac 21354812  T
409 aaggaccttttacatatttaagcct 433  Q
    | ||| |||||||||||||||||||    
21354813 agggatcttttacatatttaagcct 21354837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 309 - 431
Target Start/End: Original strand, 33609278 - 33609402
Alignment:
309 gttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnn--gatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||| ||||||||||| | | |||||||||| ||||||||||||||          |||||||||| |||||||||||||||||||||||    
33609278 gttaacgttagggattaaaaccaaaatgttcacaacttacagggtttgttttagaaagaaaaaaaagatacaaggacgaaaaccaaaaacacgcgaactt 33609377  T
407 acaaggaccttttacatatttaagc 431  Q
    ||| |||||||||||||||||||||    
33609378 acagggaccttttacatatttaagc 33609402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 318 - 434
Target Start/End: Complemental strand, 22307785 - 22307669
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    ||||||||||||||||| ||| | ||||||||||| ||||||||||||       |||||| |||  ||||||||||||| ||||||||||| |||||||    
22307785 agggactaaaaccaaaatgcttataacttacaagggttgttttagaacaaaaaacgatacagggactaaaaccaaaaacatgcgaacttacagggacctt 22307686  T
418 ttacatatttaagccta 434  Q
    || ||||||||||||||    
22307685 ttgcatatttaagccta 22307669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 44251719 - 44251604
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  ||||||||||| ||||||||||||       |||||||||| ||||||||||||||||| || ||||| ||||  |    
44251719 agggacgaaaatcaaaaagttattaacttacaagggttgttttagaacaaaaaaagatacaaggacgaaaaccaaaaacacgccaaattacagggacgat 44251620  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
44251619 ttacatatttaagcct 44251604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 315 - 429
Target Start/End: Complemental strand, 38157137 - 38157023
Alignment:
315 gttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggac 414  Q
    ||||| ||| |||||||||||  ||||||||||||||||||||||||||||         |||| ||| |||||||||||||||||||||||||| |||     
38157137 gttagagaccaaaaccaaaaaattaacaacttacaaggtttgttttagaacaaaaaaaattacagggacgaaaaccaaaaacacgcgaacttacagggat 38157038  T
415 cttttacatatttaa 429  Q
      |||||||||||||    
38157037 gatttacatatttaa 38157023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 320 - 429
Target Start/End: Original strand, 22309085 - 22309194
Alignment:
320 ggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctttt 419  Q
    ||||||||||||||| ||| | |||||||| || |||||||||||        |||||| |||  ||||||||||||||||||||||||| ||||| |||    
22309085 ggactaaaaccaaaatgcttataacttacaggggttgttttagaataaaaaaagatacagggactaaaaccaaaaacacgcgaacttacagggaccattt 22309184  T
420 acatatttaa 429  Q
    ||||||||||    
22309185 acatatttaa 22309194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 342 - 433
Target Start/End: Original strand, 42978888 - 42978979
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||| ||||||||||||       |||||| ||| ||||||||||||||||| || ||||||||||  |||||||||||||||||    
42978888 aacttacaaggattgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacaaggacgatttacatatttaagcct 42978979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 375 - 443
Target Start/End: Original strand, 23703865 - 23703933
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagataaaata 443  Q
    |||| ||||||||||||||||  |||||||||| | |||||||||||||||||||||||| | ||||||    
23703865 tacagggatgaaaaccaaaaatgcgcgaacttagagggaccttttacatatttaagcctaaaaaaaata 23703933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 375 - 430
Target Start/End: Original strand, 35786682 - 35786737
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    |||||||| ||||||||||||  |||||||||||| ||||||||||||||||||||    
35786682 tacaaggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaag 35786737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 434
Target Start/End: Original strand, 55948922 - 55949014
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||| || ||||||||||||       |||||| ||| ||||||||||||||||| || ||||||||||  ||||||||||||||||||    
55948922 aacttacaggggttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacaaggacgatttacatatttaagccta 55949014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 4906186 - 4906128
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| ||||||||||||  |||||||||||| |||||||||||||||||||||||    
4906186 tacagggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcct 4906128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 342 - 433
Target Start/End: Original strand, 42889779 - 42889870
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||| ||| |||||||||||       |||||||||| |||||| ||||||||| ||||||||| ||||  |||||||||||||||||    
42889779 aacttacatggtctgttttagaacaaaaaaagatacaaggacgaaaacaaaaaacacgtgaacttacagggacgatttacatatttaagcct 42889870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 42977312 - 42977197
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||| ||| ||||||||||||||||| || ||||||||||  |    
42977312 agggacgaaaagcaaaaagttattaacttaaatgggttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacaaggacgat 42977213  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
42977212 ttacatatttaagcct 42977197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 375 - 432
Target Start/End: Complemental strand, 4932055 - 4931998
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||| ||| ||||||||||||  |||||||||||| ||||||||||||||||||||||    
4932055 tacagggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcc 4931998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 4933342 - 4933391
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||||  |||||||||||| |||||||||||||||||||||||    
4933342 gaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcct 4933391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 29756320 - 29756271
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||||  |||||||||||| |||||||||||||||||||||||    
29756320 gaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcct 29756271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 384 - 432
Target Start/End: Original strand, 4907472 - 4907520
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    ||||||||||||  |||||||||||| ||||||||||||||||||||||    
4907472 gaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagcc 4907520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 342 - 430
Target Start/End: Complemental strand, 10337194 - 10337106
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    |||||||| || ||||||||||||       |||||||||| ||||||||||||||||| || ||||| ||||  ||||||||||||||    
10337194 aacttacaggggttgttttagaacaaaaaaagatacaaggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaag 10337106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 318 - 434
Target Start/End: Complemental strand, 19994612 - 19994496
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||| | || ||||||||||||       |||||| ||| ||||||||||||||||| || ||||| ||||  |    
19994612 agggacgaaaatcaaaaagttattaacttataggggttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacagggacgat 19994513  T
418 ttacatatttaagccta 434  Q
    |||||||||||||||||    
19994512 ttacatatttaagccta 19994496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 318 - 434
Target Start/End: Original strand, 19995999 - 19996115
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || ||||||||||||       |||||| |||  |||||||||||||||| || ||||| ||||  |    
19995999 agggacgaaaatcaaaaagttattaacttacaggggttgttttagaacaaaaaaagatacagggaccaaaaccaaaaacacgccaaattacagggacgat 19996098  T
418 ttacatatttaagccta 434  Q
    |||||||||||||||||    
19996099 ttacatatttaagccta 19996115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 384 - 431
Target Start/End: Complemental strand, 23702445 - 23702398
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    |||||| |||||  ||||||||||||||||||||||||||||||||||    
23702445 gaaaacaaaaaatgcgcgaacttacaaggaccttttacatatttaagc 23702398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 375 - 434
Target Start/End: Original strand, 29757610 - 29757669
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||| ||| ||||||||||||  || ||||||||| ||||||||||||||||||||||||    
29757610 tacagggacgaaaaccaaaaatgcgtgaacttacagggaccttttacatatttaagccta 29757669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 433
Target Start/End: Original strand, 48713431 - 48713522
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||| || ||||||||||||       |||||| ||| ||||||||||||||||| || ||||| ||||  |||||||||||||||||    
48713431 aacttacaggggttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaagcct 48713522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 384 - 434
Target Start/End: Complemental strand, 54535026 - 54534976
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||||||||||||||||| ||||  ||||||||||||| ||||    
54535026 gaaaaccaaaaacacgcgaacttacatggacgatttacatatttaaaccta 54534976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 11148397 - 11148348
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||| ||| |||||||| ||||||||||| ||||||||||||    
11148397 aaaaccaaaaacgcgctaacttacagggaccttttacttatttaagccta 11148348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 318 - 432
Target Start/End: Original strand, 32082578 - 32082692
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || || |||||||||       |||||| ||| ||||||||||||||||| || ||||| ||||  |    
32082578 agggacgaaaagcaaaaagttattaacttacaggggttattttagaacaaaaaaagatacagggacgaaaaccaaaaacacgccaaattacacggacgat 32082677  T
418 ttacatatttaagcc 432  Q
    |||||||||||||||    
32082678 ttacatatttaagcc 32082692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 373 - 434
Target Start/End: Complemental strand, 34538185 - 34538124
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||  ||||||||||||  || |||||||  ||||||||||||||||||||||||    
34538185 gatacaaggactaaaaccaaaaacgtgctaacttaccgggaccttttacatatttaagccta 34538124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 318 - 432
Target Start/End: Original strand, 39654619 - 39654731
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||||||||| | |||||||||||| ||||||||||||||         |||||  || ||||||||||| ||||| |||||||| ||| |||    
39654619 agggacgaaaaccaaaaggttaacaacttacatggtttgttttagaa--aaaaaaaatacagtgacgaaaaccaaaatcacgccaacttacagggatctt 39654716  T
418 ttacatatttaagcc 432  Q
    ||| |||||||||||    
39654717 ttaaatatttaagcc 39654731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 373 - 430
Target Start/End: Complemental strand, 48711917 - 48711860
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    |||||||||| |||||| |||||||||| || ||||||||||  ||||||||||||||    
48711917 gatacaaggacgaaaacaaaaaacacgcaaaattacaaggacgatttacatatttaag 48711860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 375 - 440
Target Start/End: Original strand, 55019359 - 55019424
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagataaa 440  Q
    |||| ||| |||||| |||||  |||||| ||||||||||| |||||||||||||||||| |||||    
55019359 tacagggaagaaaacaaaaaatgcgcgaaattacaaggaccatttacatatttaagcctaaataaa 55019424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 313 - 365
Target Start/End: Complemental strand, 55017860 - 55017808
Alignment:
313 acgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaac 365  Q
    ||||||||||| |||||||| ||  |||||||||||||||||| |||||||||    
55017860 acgttagggaccaaaaccaataaattaacaacttacaaggtttattttagaac 55017808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 374 - 433
Target Start/End: Original strand, 18597855 - 18597914
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||| ||| ||||||||||||||||| || ||||| ||||  |||||||||||||||||    
18597855 atacagggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaagcct 18597914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 375 - 430
Target Start/End: Complemental strand, 22674209 - 22674154
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    |||||||| |||||| |||||  |||||||||| | ||||||||||||||||||||    
22674209 tacaaggacgaaaacaaaaaatgcgcgaacttatagggaccttttacatatttaag 22674154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 390 - 433
Target Start/End: Original strand, 39929371 - 39929414
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||| ||||| |||| ||||||||||||||||||    
39929371 caaaaacacgcgaaattacatggacgttttacatatttaagcct 39929414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 385 - 431
Target Start/End: Complemental strand, 35785212 - 35785166
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    ||||| ||||| ||||||||||||| ||| |||||||||||||||||    
35785212 aaaacaaaaaatacgcgaacttacatggatcttttacatatttaagc 35785166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 385 - 434
Target Start/End: Complemental strand, 2671588 - 2671539
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||  |||||||||||| ||||||||| | ||||||||||||    
2671588 aaaaccaaaaatgcgcgaacttacagggacctttttcttatttaagccta 2671539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 384 - 424
Target Start/End: Complemental strand, 9561894 - 9561854
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacata 424  Q
    |||||||||||||||||||||||||| ||||  ||||||||    
9561894 gaaaaccaaaaacacgcgaacttacagggacgatttacata 9561854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 374 - 434
Target Start/End: Original strand, 54123546 - 54123606
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||| ||| |||||||||||||| || || ||||| ||||  ||||||||||||||||||    
54123546 atacagggacgaaaaccaaaaacatgccaaattacagggacgatttacatatttaagccta 54123606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0280 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: scaffold0280
Description:

Target: scaffold0280; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 307 - 437
Target Start/End: Complemental strand, 12257 - 12126
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttag-aacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaact 405  Q
    |||||||||||||||||||||||||||| | |||||||||||| |||||||||||| ||        |||||| ||| ||||||||||||||||||||||    
12257 aagttaacgttagggactaaaaccaaaaggttaacaacttacagggtttgttttagaaagaaaaaaagatacagggacgaaaaccaaaaacacgcgaact 12158  T
406 tacaaggaccttttacatatttaagcctagat 437  Q
    |||  | |||||||||||||||||||||||||    
12157 taccggaaccttttacatatttaagcctagat 12126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 66; Significance: 7e-29; HSPs: 31)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 307 - 432
Target Start/End: Complemental strand, 32614008 - 32613883
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaac-t 405  Q
    |||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||         |||| ||| ||||||||||||||||||||| |    
32614008 aagttaacgttagggactaaaaccaaaaagttaacaacttacagggtttattttagaacaaaaaaa-ctacagggacgaaaaccaaaaacacgcgaactt 32613910  T
406 tacaaggaccttttacatatttaagcc 432  Q
    |||||||||||||||||||||||||||    
32613909 tacaaggaccttttacatatttaagcc 32613883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 307 - 434
Target Start/End: Complemental strand, 32559045 - 32558917
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaa-cttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaact 405  Q
    |||||||||||||||||||||||||||||| |||||| ||||||  ||||||||| ||||       | |||| ||| |||||| |||||||||||||||    
32559045 aagttaacgttagggactaaaaccaaaaagttaacaaacttacagagtttgttttcgaacaaaaaaagttacagggacgaaaacaaaaaacacgcgaact 32558946  T
406 tacaaggaccttttacatatttaagccta 434  Q
    |||| ||||||||||||||||||||||||    
32558945 tacagggaccttttacatatttaagccta 32558917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 307 - 433
Target Start/End: Complemental strand, 41081927 - 41081801
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       |||||| ||| |||||||||||||||||||||||    
41081927 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaactt 41081828  T
407 acaaggaccttttacatatttaagcct 433  Q
    ||| |||||||||||||||||||||||    
41081827 acagggaccttttacatatttaagcct 41081801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 307 - 434
Target Start/End: Original strand, 32559815 - 32559944
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnnga--tacaaggatgaaaaccaaaaacacgcgaac 404  Q
    ||||| |||||| | |||||||| |||||| ||||||||||||||||||||||||||||        |  |||| |||||||||  ||||||||||||||    
32559815 aagtttacgttatgaactaaaactaaaaagttaacaacttacaaggtttgttttagaacaaaaaaaaagttacagggatgaaaataaaaaacacgcgaac 32559914  T
405 ttacaaggaccttttacatatttaagccta 434  Q
    |||||  |||||||||||||||||||||||    
32559915 ttacagagaccttttacatatttaagccta 32559944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 307 - 433
Target Start/End: Complemental strand, 48567121 - 48566995
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       ||||||  || ||||||||||||||||| |||||    
48567121 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacagtgacgaaaaccaaaaacacgcaaactt 48567022  T
407 acaaggaccttttacatatttaagcct 433  Q
    ||| |||||||||||||||||||||||    
48567021 acagggaccttttacatatttaagcct 48566995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 307 - 432
Target Start/End: Complemental strand, 31795498 - 31795373
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||| ||| ||||||| |||  ||||||| || ||||||||| |||||||||||||||       |||||| ||  |||||||||||||||||||||||    
31795498 aagttgacggtagggacgaaattcaaaaagttatcaacttacagggtttgttttagaacaaaaaaagatacagggccgaaaaccaaaaacacgcgaactt 31795399  T
407 acaaggaccttttacatatttaagcc 432  Q
    ||| ||||||||||| ||||||||||    
31795398 acagggaccttttacgtatttaagcc 31795373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 245 - 429
Target Start/End: Original strand, 32615518 - 32615702
Alignment:
245 aacgcgaactcaaccttcgccacatgtgtctttgtttgccagcaacgtgnnnnnnnaacagaaagttaacgttagggactaaaaccaaaaagctaacaac 344  Q
    ||||| |||||| ||||||||||  |||| |  ||||||||||||||||       ||| ||| ||| |||||||||||||||| ||||||| |||||||    
32615518 aacgccaactcagccttcgccacgcgtgtttccgtttgccagcaacgtgtttttttaacggaa-gtttacgttagggactaaaatcaaaaagttaacaac 32615616  T
345 ttacaaggtttgttttagaac-nnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    ||||| | |||||||||||||        | |||| |||  ||||| ||||||||||||||||||| |||||||||||||||||||    
32615617 ttacatgatttgttttagaacaaaaaaaagttacagggacaaaaacaaaaaacacgcgaacttacagggaccttttacatatttaa 32615702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 318 - 432
Target Start/End: Original strand, 31796779 - 31796893
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || ||||||||||||       |||||  ||| |||||||||||||||||||||||||| |||||||    
31796779 agggacgaaaatcaaaaagttattaacttacaggggttgttttagaacaaaaaaagatacggggacgaaaaccaaaaacacgcgaacttacagggacctt 31796878  T
418 ttacatatttaagcc 432  Q
    |||||||||||||||    
31796879 ttacatatttaagcc 31796893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 318 - 433
Target Start/End: Original strand, 40499197 - 40499312
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||  || ||||||||||||       |||||  ||| |||||||||||||||||||||||||| |||||||    
40499197 agggacgaaaatcaaaaagttattaacttaccggggttgttttagaacaaaaaaagatacggggacgaaaaccaaaaacacgcgaacttacagggacctt 40499296  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
40499297 ttacatatttaagcct 40499312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 384 - 434
Target Start/End: Original strand, 41083282 - 41083332
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||||||||| |||||||| ||||||||||||||||||||||||    
41083282 gaaaaccaaaaacacgcaaacttacagggaccttttacatatttaagccta 41083332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 318 - 432
Target Start/End: Original strand, 48568475 - 48568589
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    |||||| |||| ||||||| ||  |||||||| || ||||||||||||        ||||  ||| ||||||||||||||||||||||||||  ||||||    
48568475 agggacgaaaatcaaaaagttattaacttacaggggttgttttagaacaaaaaaaaatacggggacgaaaaccaaaaacacgcgaacttacagagacctt 48568574  T
418 ttacatatttaagcc 432  Q
    |||||||||||||||    
48568575 ttacatatttaagcc 48568589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 375 - 429
Target Start/End: Original strand, 33781496 - 33781550
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    |||||||| |||||| |||||| |||||||||||| |||||||||||||||||||    
33781496 tacaaggacgaaaacaaaaaacgcgcgaacttacagggaccttttacatatttaa 33781550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 25529929 - 25529977
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||| ||| |||||||||||||||||||| |||||||||||    
25529929 aaaaccaaaaacgcgccaacttacaaggaccttttacttatttaagcct 25529977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 374 - 429
Target Start/End: Complemental strand, 22942394 - 22942339
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    ||||| |||||||||||||||||| ||||||||||| ||||  |||||||||||||    
22942394 atacagggatgaaaaccaaaaacaagcgaacttacagggacgatttacatatttaa 22942339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 384 - 431
Target Start/End: Complemental strand, 24612326 - 24612279
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    ||||||||||||  |||||||||||| |||||||||||||||||||||    
24612326 gaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagc 24612279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 390 - 433
Target Start/End: Complemental strand, 45981449 - 45981406
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||| |||||||||| ||||||||||||||||||    
45981449 caaaaacacgcgaaattacaaggacgttttacatatttaagcct 45981406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 342 - 429
Target Start/End: Complemental strand, 30700386 - 30700299
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    |||||||| ||| |||||||||||       |||||||||| |||||||||||||||||||||||| |  |||  |||||||||||||    
30700386 aacttacagggtgtgttttagaacaaaaaaagatacaaggacgaaaaccaaaaacacgcgaacttaaagagacgatttacatatttaa 30700299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 306 - 364
Target Start/End: Original strand, 33552957 - 33553015
Alignment:
306 aaagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaa 364  Q
    ||||||||| ||| |||||||||| |||||| ||||||||||||| |||| ||||||||    
33552957 aaagttaacattaaggactaaaactaaaaagttaacaacttacaaagtttattttagaa 33553015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 307 - 349
Target Start/End: Original strand, 41881587 - 41881629
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttaca 349  Q
    |||||||||||||||||||||||||||| | ||||||||||||    
41881587 aagttaacgttagggactaaaaccaaaaggttaacaacttaca 41881629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 3150031 - 3150080
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||||| ||  |||||||| ||||||||||||||||||||||||    
3150031 aaaaccaaaaacgcgttaacttacagggaccttttacatatttaagccta 3150080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 307 - 433
Target Start/End: Complemental strand, 44458720 - 44458594
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||||||||||||||||||||  |||| | |||||||||||| | |   |||||||||         |||||||| ||||| ||| |||||  ||||||    
44458720 aagttaacgttagggactaaaattaaaaggttaacaacttacaggatcatttttagaacaaaaaaacttacaaggacgaaaatcaagaacacatgaactt 44458621  T
407 acaaggaccttttacatatttaagcct 433  Q
    ||| |||| ||||||||||||||||||    
44458620 acagggactttttacatatttaagcct 44458594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 390 - 433
Target Start/End: Complemental strand, 8391443 - 8391400
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||| ||||| |||| ||||||||||||||||||    
8391443 caaaaacacgcgaaattacagggacgttttacatatttaagcct 8391400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 375 - 430
Target Start/End: Original strand, 24613614 - 24613669
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaag 430  Q
    |||| ||| |||||| |||||  |||||||||||| ||||||||||||||||||||    
24613614 tacagggacgaaaacaaaaaatgcgcgaacttacagggaccttttacatatttaag 24613669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 342 - 434
Target Start/End: Complemental strand, 41880014 - 41879922
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||||||||||||||||       ||||||  || ||||||||||||||| ||||||||||   ||  ||||||||||||| ||||    
41880014 aacttacaaggtttgttttagaacaaaaaaagatacagagacgaaaaccaaaaacacacgaacttacagaaacgatttacatatttaaaccta 41879922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 385 - 432
Target Start/End: Complemental strand, 55196621 - 55196574
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||||||||  |||||||||||||||||||||| | ||||||||||    
55196621 aaaaccaaaaatgcgcgaacttacaaggacctttttcttatttaagcc 55196574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 375 - 433
Target Start/End: Complemental strand, 33780714 - 33780656
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||| ||| |||||| ||||| ||||||||||||| |||| |||||||| |||||||||    
33780714 tacagggacgaaaacaaaaaatacgcgaacttacagggacattttacatttttaagcct 33780656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 379 - 409
Target Start/End: Original strand, 41881629 - 41881659
Alignment:
379 aggatgaaaaccaaaaacacgcgaacttaca 409  Q
    |||||||||||||||||||||||||||||||    
41881629 aggatgaaaaccaaaaacacgcgaacttaca 41881659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 375 - 432
Target Start/End: Complemental strand, 31199306 - 31199249
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||| ||| ||||||| |||| ||||||| ||||| |||||||||||||||| |||||    
31199306 tacagggacgaaaacctaaaatacgcgaaattacagggaccttttacatattcaagcc 31199249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 33733013 - 33732964
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||||||||| || ||||| ||||  |||||||||||||||||    
33733013 gaaaaccaaaaacacgccaaattacagggacgatttacatatttaagcct 33732964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 385 - 433
Target Start/End: Original strand, 3026893 - 3026941
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||||||||||  || |||||||| ||||||||||| |||||||||||    
3026893 aaaaccaaaaacgtgccaacttacagggaccttttacttatttaagcct 3026941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 373 - 429
Target Start/End: Original strand, 46725269 - 46725325
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaa 429  Q
    |||||||||| |||   |||||||||||||||| ||| |||| ||||||||||||||    
46725269 gatacaaggacgaattacaaaaacacgcgaactaacagggacattttacatatttaa 46725325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1176 (Bit Score: 58; Significance: 4e-24; HSPs: 1)
Name: scaffold1176
Description:

Target: scaffold1176; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 307 - 433
Target Start/End: Complemental strand, 2176 - 2050
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||||||||| | | | |||||||  || ||||||||||||       |||||| ||| | |||||||||||||||||||||    
2176 aagttaacgttagggactaaaaccaaaacgtttataacttacgggggttgttttagaacaaaaaaagatacagggacggaaaccaaaaacacgcgaactt 2077  T
407 acaaggaccttttacatatttaagcct 433  Q
    |||||||| |||| |||||||||||||    
2076 acaaggacatttttcatatttaagcct 2050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 55; Significance: 2e-22; HSPs: 23)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 318 - 433
Target Start/End: Complemental strand, 39884730 - 39884615
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    ||||||||||||||||| ||| | ||||||||||| || |||||||||       |||||| |||  ||||||||||||||||||||||||| ||||| |    
39884730 agggactaaaaccaaaatgcttataacttacaagggttattttagaacaaaaaaagatacagggactaaaaccaaaaacacgcgaacttacagggaccat 39884631  T
418 ttacatatttaagcct 433  Q
    ||||||||||||||||    
39884630 ttacatatttaagcct 39884615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 318 - 434
Target Start/End: Original strand, 39886021 - 39886137
Alignment:
318 agggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggacctt 417  Q
    ||||||||||||||||| ||| | |||||||| || |||||||||||        |||||| |||  ||||||||||||||||||||||||| ||||| |    
39886021 agggactaaaaccaaaatgcttataacttacaggggttgttttagaataaaaaaagatacagggactaaaaccaaaaacacgcgaacttacagggaccat 39886120  T
418 ttacatatttaagccta 434  Q
    |||||||||||||||||    
39886121 ttacatatttaagccta 39886137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 309 - 432
Target Start/End: Original strand, 45448426 - 45448551
Alignment:
309 gttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnn--gatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    ||||||||||| |||||||||||||| | | |||||||| | ||||||||||||||          |||| ||||| |||||||||||||||||||||||    
45448426 gttaacgttagagactaaaaccaaaatgttcacaacttatagggtttgttttagaagaaaaaaaaagatataaggacgaaaaccaaaaacacgcgaactt 45448525  T
407 acaaggaccttttacatatttaagcc 432  Q
    | | ||||||||||||||||||||||    
45448526 agagggaccttttacatatttaagcc 45448551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 342 - 434
Target Start/End: Original strand, 3158006 - 3158098
Alignment:
342 aacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||| ||| |||||||||||       |||||| ||| |||||||||||||||||||||||||| ||||  ||||||||||||||||||    
3158006 aacttacagggtctgttttagaacaaaaaaagatacagggacgaaaaccaaaaacacgcgaacttacagggacgatttacatatttaagccta 3158098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 373 - 431
Target Start/End: Original strand, 15279633 - 15279691
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    ||||||| || |||||||||||||||||||||||||||||||  |||||||||||||||    
15279633 gatacaatgacgaaaaccaaaaacacgcgaacttacaaggacgatttacatatttaagc 15279691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 373 - 431
Target Start/End: Original strand, 15460002 - 15460060
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    ||||||| || |||||||||||||||||||||||||||||||  |||||||||||||||    
15460002 gatacaatgacgaaaaccaaaaacacgcgaacttacaaggacgatttacatatttaagc 15460060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 375 - 434
Target Start/End: Complemental strand, 358034 - 357975
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||| ||| ||||||||||||  |||||||||||| ||||||||||||||||||||||||    
358034 tacagggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagccta 357975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 375 - 434
Target Start/End: Complemental strand, 17706222 - 17706163
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||  |||||||||||||||| || ||||| ||||||||||||||||||||||||    
17706222 tacaaggactaaaaccaaaaacacgctaaattacagggaccttttacatatttaagccta 17706163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 1650221 - 1650270
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| ||||||||||||||||||||||||  |||||||||||||||||    
1650221 gaaaactaaaaacacgcgaacttacaaggacggtttacatatttaagcct 1650270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 373 - 434
Target Start/End: Complemental strand, 25264399 - 25264338
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||||||| ||||||||||||||||| || ||||| ||||  ||||||||||||||||||    
25264399 gatacaaggacgaaaaccaaaaacacgccaaattacagggacgatttacatatttaagccta 25264338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 375 - 431
Target Start/End: Complemental strand, 21142536 - 21142480
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagc 431  Q
    |||||||| |||||| |||||  |||||||||||| |||||||||||||||||||||    
21142536 tacaaggacgaaaacaaaaaatgcgcgaacttacagggaccttttacatatttaagc 21142480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 385 - 433
Target Start/End: Complemental strand, 36899945 - 36899897
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||||||||| || ||||| |||||||||||||||||||||||    
36899945 aaaaccaaaaacacgctaaattacagggaccttttacatatttaagcct 36899897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 385 - 439
Target Start/End: Original strand, 17707460 - 17707514
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctagataa 439  Q
    |||||||||||||||| || ||||| ||||| |||||||||||||||||| ||||    
17707460 aaaaccaaaaacacgctaaattacatggaccatttacatatttaagcctatataa 17707514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 384 - 433
Target Start/End: Original strand, 359325 - 359374
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||| |||||  |||||||||||| |||||||||||||||||||||||    
359325 gaaaacaaaaaatgcgcgaacttacagggaccttttacatatttaagcct 359374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 307 - 348
Target Start/End: Original strand, 27339115 - 27339156
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttac 348  Q
    ||||||||||||| |||||||||||||||| |||||||||||    
27339115 aagttaacgttagagactaaaaccaaaaagttaacaacttac 27339156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 385 - 434
Target Start/End: Original strand, 36901189 - 36901238
Alignment:
385 aaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||| ||||||||||| || ||||| ||||||||||||||||||||||||    
36901189 aaaaacaaaaacacgctaaattacagggaccttttacatatttaagccta 36901238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 384 - 436
Target Start/End: Complemental strand, 37963322 - 37963270
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcctaga 436  Q
    |||||| |||||| ||| || ||||||||||||||||||||||||||| ||||    
37963322 gaaaacaaaaaacgcgctaagttacaaggaccttttacatatttaagcttaga 37963270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 374 - 433
Target Start/End: Original strand, 22714050 - 22714109
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    ||||| ||| ||||||||||||||| |||||||||| || |  |||||||||||||||||    
22714050 atacagggacgaaaaccaaaaacacacgaacttacaggggcgatttacatatttaagcct 22714109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 373 - 432
Target Start/End: Complemental strand, 26719444 - 26719385
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcc 432  Q
    |||||||||| |||||| ||||||||||||||||||| |||   ||||||||| ||||||    
26719444 gatacaaggacgaaaacaaaaaacacgcgaacttacatggatgatttacatatataagcc 26719385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 313 - 432
Target Start/End: Complemental strand, 44690139 - 44690020
Alignment:
313 acgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaacttacaagg 412  Q
    ||||||||||| ||  |||||||| ||||||  |||||||  ||||||| |||       |||||| |||| |||| |||||| |  | ||||||| |||    
44690139 acgttagggaccaattccaaaaagttaacaagatacaagggctgttttacaacaaaaaaagatacagggattaaaagcaaaaatagtccaacttactagg 44690040  T
413 accttttacatatttaagcc 432  Q
    ||||||||||||||||||||    
44690039 accttttacatatttaagcc 44690020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 374 - 414
Target Start/End: Original strand, 2552753 - 2552793
Alignment:
374 atacaaggatgaaaaccaaaaacacgcgaacttacaaggac 414  Q
    ||||||| |||||||| ||||||||||||||||||| ||||    
2552753 atacaagaatgaaaacaaaaaacacgcgaacttacagggac 2552793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 373 - 433
Target Start/End: Complemental strand, 33293998 - 33293938
Alignment:
373 gatacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagcct 433  Q
    |||||||||| ||||||||||||| ||  || ||||||||||  |||| ||||||||||||    
33293998 gatacaaggacgaaaaccaaaaacgcgtcaaattacaaggacgatttatatatttaagcct 33293938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 390 - 434
Target Start/End: Original strand, 35506945 - 35506989
Alignment:
390 caaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    ||||||||||| || |||||| ||| |||||||||||||||||||    
35506945 caaaaacacgcaaaattacaaagacgttttacatatttaagccta 35506989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1118 (Bit Score: 49; Significance: 9e-19; HSPs: 1)
Name: scaffold1118
Description:

Target: scaffold1118; HSP #1
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 307 - 424
Target Start/End: Complemental strand, 2537 - 2420
Alignment:
307 aagttaacgttagggactaaaaccaaaaagctaacaacttacaaggtttgttttagaacnnnnnnngatacaaggatgaaaaccaaaaacacgcgaactt 406  Q
    |||||||||||||||||||||||||||| ||  | |||||||| || |||||||| ||        |||| | ||| |||||||||||||||||||||||    
2537 aagttaacgttagggactaaaaccaaaacgcgtataacttacaggggttgttttaaaataaaaaaagatatagggacgaaaaccaaaaacacgcgaactt 2438  T
407 acaaggaccttttacata 424  Q
    ||| ||||||||||||||    
2437 acagggaccttttacata 2420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0129 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0129
Description:

Target: scaffold0129; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 375 - 434
Target Start/End: Original strand, 4259 - 4318
Alignment:
375 tacaaggatgaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||| ||| ||||||||||||  |||||||||||| ||||||||||||||||||||||||    
4259 tacagggacgaaaaccaaaaatgcgcgaacttacagggaccttttacatatttaagccta 4318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0060 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0060
Description:

Target: scaffold0060; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 384 - 434
Target Start/End: Original strand, 13262 - 13312
Alignment:
384 gaaaaccaaaaacacgcgaacttacaaggaccttttacatatttaagccta 434  Q
    |||||| |||||  || ||||||||| ||||||||||||||||||||||||    
13262 gaaaacaaaaaatgcgtgaacttacagggaccttttacatatttaagccta 13312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199806 times since January 2019
Visitors: 908