View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-11 (Length: 128)

Name: F9164J-LTR4-TNT-insertion-11
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-11
F9164J-LTR4-TNT-insertion-11
[»] chr4 (1 HSPs)
chr4 (8-118)||(45544810-45544920)


Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 45544920 - 45544810
Alignment:
8 caaggtgatgccagattgttcactcttgatctccgtttcaagagcaggagaaactggttcacacttgatcaacataagatacctaatacaaatcgcaaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45544920 caaggtgatgccagattgttcactcttgatctccgtttcaagagcaggagaaactggttcacacttgatcaacataagatacctaatacaaatcgcaaaa 45544821  T
108 taatttaatta 118  Q
    |||||||||||    
45544820 taatttaatta 45544810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199773 times since January 2019
Visitors: 908