View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-12 (Length: 215)

Name: F9164J-LTR4-TNT-insertion-12
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-12
[»] chr4 (1 HSPs)
chr4 (8-205)||(21093753-21093950)

Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 8 - 205
Target Start/End: Original strand, 21093753 - 21093950
8 gtattagcataataactatatcatgctccctaatgtattgttctttaaaagcttagagttttctcaatgttgatatatagaaaagaataacaattattga 107  Q
21093753 gtattagcataataactatatcatgctccctaatgtattgttctttaaaagcttagagttttctcaatgttgatatatagaaaagaataacaattattga 21093852  T
108 agaaatggattaaatattatagggccataggcatagcagaaaataataaatttatttgnnnnnnnntaatatatttattgtgcaagtttatttaatta 205  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||    
21093853 agaaatggattaaatattatagggccataggcatagcagaaaataataaatttatttgaaaaaaaataatatatttattgtgcaagtttatttaatta 21093950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC