View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-13 (Length: 655)

Name: F9164J-LTR4-TNT-insertion-13
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-13
[»] chr8 (1 HSPs)
chr8 (8-647)||(38215536-38216175)

Alignment Details
Target: chr8 (Bit Score: 636; Significance: 0; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 636; E-Value: 0
Query Start/End: Original strand, 8 - 647
Target Start/End: Complemental strand, 38216175 - 38215536
8 aaaatacaatacaacaaaatctcattaactttatactatagtaagagaaatatcaatatgtctgacattgctatgttagtagctgaggagtatgagagaa 107  Q
38216175 aaaatacaatacaacaaaatctcattaactttatactatagtaagagaaatatcaatatgtctgacattgctatgttagtagctgaggagtatgagagaa 38216076  T
108 gagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagatcaacatgtcttcttgttattcactattcgtttccaagttgaagga 207  Q
38216075 gagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagatcaacatgtcttcttgttattcactattcgtttccaagttgaagga 38215976  T
208 ggagaaaaggcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttctaacaacttcttttctgcttgatcaaataagtcgatc 307  Q
38215975 ggagaaaaggcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttctaacaacttcttttctgcttgatcaaataagtcgatc 38215876  T
308 attgatataatttacttactttgtttgctgtaatttgtttttattttatggtcttctagttttcatgaaatcttttgtacatagctatgcttggaatatg 407  Q
38215875 attgatataatttacttactttgtttgctgtaatttgtttttattttatggtcttctagttttcatgaaatcttttgtacatagctatgcttggaatatg 38215776  T
408 aatctgaattaacggttgtctttagagaatttctctcacataattaaggatttaaaggatattcacttggagtataaaattgatttgccacgtcaaaatt 507  Q
38215775 aatctgaattaacggttgtctttagagaatttctctcacataattaaggatttaaaggatattcacttggagtataaaattgatttgccacgtcaaaatt 38215676  T
508 caatcagttttacactcgcatctaatcaaaatctaatgttttgccacatcatctctattggttacttgatcattaaactctaaaaaatagtgggtcgata 607  Q
38215675 caatcagttttacactcgcatctaatcaaaatctaatgttttgccacatcatctctattggttacttgatcattaaactctaaaaaatagtgggtcgata 38215576  T
608 attttgtgaccgaaacaaatatcttcatcatactaattgg 647  Q
    ||||||||||||||||||||||||||||||||| ||||||    
38215575 attttgtgaccgaaacaaatatcttcatcataccaattgg 38215536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC