View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-13 (Length: 655)

Name: F9164J-LTR4-TNT-insertion-13
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-13
F9164J-LTR4-TNT-insertion-13
[»] chr8 (1 HSPs)
chr8 (8-647)||(38215536-38216175)


Alignment Details
Target: chr8 (Bit Score: 636; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 636; E-Value: 0
Query Start/End: Original strand, 8 - 647
Target Start/End: Complemental strand, 38216175 - 38215536
Alignment:
8 aaaatacaatacaacaaaatctcattaactttatactatagtaagagaaatatcaatatgtctgacattgctatgttagtagctgaggagtatgagagaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38216175 aaaatacaatacaacaaaatctcattaactttatactatagtaagagaaatatcaatatgtctgacattgctatgttagtagctgaggagtatgagagaa 38216076  T
108 gagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagatcaacatgtcttcttgttattcactattcgtttccaagttgaagga 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38216075 gagtcaagagtttaaaaaatgctggtggtgctgctgctgtagaaacatgggagatcaacatgtcttcttgttattcactattcgtttccaagttgaagga 38215976  T
208 ggagaaaaggcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttctaacaacttcttttctgcttgatcaaataagtcgatc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38215975 ggagaaaaggcaacttgttcagagtgttttggaacccaaaacccaatttgctattgctgcttctaacaacttcttttctgcttgatcaaataagtcgatc 38215876  T
308 attgatataatttacttactttgtttgctgtaatttgtttttattttatggtcttctagttttcatgaaatcttttgtacatagctatgcttggaatatg 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38215875 attgatataatttacttactttgtttgctgtaatttgtttttattttatggtcttctagttttcatgaaatcttttgtacatagctatgcttggaatatg 38215776  T
408 aatctgaattaacggttgtctttagagaatttctctcacataattaaggatttaaaggatattcacttggagtataaaattgatttgccacgtcaaaatt 507  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38215775 aatctgaattaacggttgtctttagagaatttctctcacataattaaggatttaaaggatattcacttggagtataaaattgatttgccacgtcaaaatt 38215676  T
508 caatcagttttacactcgcatctaatcaaaatctaatgttttgccacatcatctctattggttacttgatcattaaactctaaaaaatagtgggtcgata 607  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38215675 caatcagttttacactcgcatctaatcaaaatctaatgttttgccacatcatctctattggttacttgatcattaaactctaaaaaatagtgggtcgata 38215576  T
608 attttgtgaccgaaacaaatatcttcatcatactaattgg 647  Q
    ||||||||||||||||||||||||||||||||| ||||||    
38215575 attttgtgaccgaaacaaatatcttcatcataccaattgg 38215536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 94923 times since January 2019
Visitors: 2222