View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-14 (Length: 576)

Name: F9164J-LTR4-TNT-insertion-14
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-14
F9164J-LTR4-TNT-insertion-14
[»] chr1 (112 HSPs)
chr1 (24-569)||(1565407-1565952)
chr1 (144-220)||(6292495-6292571)
chr1 (125-255)||(31517713-31517843)
chr1 (150-246)||(7472287-7472384)
chr1 (123-220)||(10199379-10199476)
chr1 (24-121)||(26946129-26946229)
chr1 (24-83)||(6337781-6337840)
chr1 (131-229)||(37811845-37811943)
chr1 (146-255)||(34290203-34290312)
chr1 (148-212)||(37593680-37593744)
chr1 (124-195)||(11639388-11639459)
chr1 (125-235)||(7136971-7137081)
chr1 (144-242)||(43332464-43332562)
chr1 (144-220)||(27140480-27140556)
chr1 (131-203)||(28689431-28689503)
chr1 (146-246)||(41195187-41195287)
chr1 (24-83)||(4068117-4068176)
chr1 (24-87)||(18327522-18327585)
chr1 (59-115)||(26946015-26946073)
chr1 (161-255)||(24915060-24915154)
chr1 (123-197)||(43338141-43338215)
chr1 (161-246)||(2294887-2294972)
chr1 (24-73)||(15515372-15515421)
chr1 (144-197)||(26184773-26184826)
chr1 (24-114)||(35590099-35590191)
chr1 (132-197)||(35925715-35925780)
chr1 (148-220)||(4622095-4622167)
chr1 (144-220)||(27963362-27963438)
chr1 (144-219)||(4202143-4202218)
chr1 (125-220)||(10744303-10744398)
chr1 (144-203)||(11695880-11695939)
chr1 (148-255)||(17628566-17628673)
chr1 (161-220)||(35179141-35179200)
chr1 (164-255)||(37631571-37631662)
chr1 (148-203)||(46252678-46252733)
chr1 (24-83)||(48819301-48819360)
chr1 (24-74)||(26988159-26988209)
chr1 (24-115)||(37712036-37712128)
chr1 (125-183)||(45394154-45394212)
chr1 (161-235)||(45975677-45975751)
chr1 (148-253)||(7218070-7218175)
chr1 (148-205)||(8016274-8016331)
chr1 (144-185)||(10854770-10854811)
chr1 (161-254)||(27820346-27820439)
chr1 (131-220)||(37842334-37842423)
chr1 (126-199)||(38170664-38170737)
chr1 (146-203)||(44815297-44815354)
chr1 (29-121)||(391130-391225)
chr1 (125-196)||(3887604-3887676)
chr1 (24-80)||(37329437-37329493)
chr1 (125-185)||(42757150-42757210)
chr1 (148-187)||(1509961-1510000)
chr1 (24-83)||(3069879-3069938)
chr1 (131-186)||(4481966-4482021)
chr1 (147-198)||(5886989-5887040)
chr1 (141-252)||(10809315-10809426)
chr1 (149-220)||(25479583-25479654)
chr1 (24-121)||(28689964-28690065)
chr1 (149-220)||(30257685-30257756)
chr1 (144-187)||(30815645-30815688)
chr1 (24-83)||(31378776-31378835)
chr1 (144-255)||(36151497-36151608)
chr1 (24-83)||(36423006-36423065)
chr1 (24-83)||(41129996-41130055)
chr1 (146-197)||(44422724-44422775)
chr1 (125-255)||(51695467-51695597)
chr1 (149-251)||(4576776-4576878)
chr1 (134-196)||(4699597-4699659)
chr1 (148-202)||(6262040-6262094)
chr1 (161-214)||(10089716-10089767)
chr1 (24-74)||(10850096-10850146)
chr1 (145-183)||(12477280-12477318)
chr1 (131-216)||(15942726-15942812)
chr1 (24-74)||(16888991-16889040)
chr1 (173-215)||(21254768-21254810)
chr1 (146-184)||(24460401-24460439)
chr1 (125-179)||(38001639-38001693)
chr1 (149-203)||(47877128-47877182)
chr1 (131-240)||(2777874-2777983)
chr1 (145-198)||(4445732-4445785)
chr1 (125-182)||(4549888-4549945)
chr1 (125-213)||(7941615-7941704)
chr1 (24-89)||(10082246-10082311)
chr1 (149-198)||(10799486-10799535)
chr1 (146-215)||(12564493-12564562)
chr1 (147-220)||(12593448-12593521)
chr1 (156-197)||(15361065-15361106)
chr1 (149-198)||(21002184-21002233)
chr1 (146-251)||(34405128-34405233)
chr1 (164-253)||(34952184-34952273)
chr1 (131-203)||(38503443-38503516)
chr1 (135-220)||(39270408-39270493)
chr1 (125-194)||(48748289-48748357)
chr1 (192-255)||(3069974-3070038)
chr1 (148-180)||(3070086-3070118)
chr1 (148-216)||(4868406-4868474)
chr1 (130-198)||(7575677-7575744)
chr1 (163-215)||(11129252-11129304)
chr1 (24-121)||(15791346-15791444)
chr1 (148-220)||(16322851-16322923)
chr1 (146-194)||(20713684-20713732)
chr1 (148-244)||(23445312-23445408)
chr1 (132-220)||(23902047-23902135)
chr1 (24-121)||(26435200-26435298)
chr1 (156-216)||(28077073-28077133)
chr1 (151-255)||(30371115-30371219)
chr1 (147-195)||(33975597-33975645)
chr1 (123-178)||(35350684-35350739)
chr1 (170-246)||(38018382-38018458)
chr1 (163-203)||(39603842-39603882)
chr1 (56-121)||(41196615-41196682)
chr1 (145-181)||(45999281-45999317)
[»] chr8 (62 HSPs)
chr8 (24-119)||(32131404-32131501)
chr8 (146-255)||(12361159-12361268)
chr8 (146-251)||(37353243-37353348)
chr8 (161-248)||(27028805-27028892)
chr8 (125-255)||(42215279-42215409)
chr8 (27-83)||(34286591-34286647)
chr8 (131-245)||(10120733-10120848)
chr8 (24-83)||(28879060-28879119)
chr8 (129-183)||(3254264-3254318)
chr8 (147-197)||(20672775-20672825)
chr8 (147-220)||(11795094-11795167)
chr8 (131-195)||(2458545-2458609)
chr8 (144-220)||(11569449-11569525)
chr8 (123-214)||(27754412-27754503)
chr8 (24-83)||(32975689-32975748)
chr8 (123-220)||(1930037-1930135)
chr8 (150-220)||(28769337-28769407)
chr8 (149-271)||(28784793-28784914)
chr8 (131-194)||(13459673-13459736)
chr8 (164-251)||(18133627-18133714)
chr8 (148-203)||(21653100-21653155)
chr8 (148-195)||(31862520-31862567)
chr8 (24-83)||(32213047-32213106)
chr8 (24-83)||(35453412-35453471)
chr8 (132-255)||(38537558-38537681)
chr8 (149-195)||(9700028-9700074)
chr8 (161-255)||(10114457-10114550)
chr8 (132-194)||(10383913-10383975)
chr8 (133-195)||(12851203-12851265)
chr8 (142-220)||(34290871-34290949)
chr8 (24-66)||(35168466-35168508)
chr8 (146-255)||(30389066-30389175)
chr8 (148-220)||(7714244-7714316)
chr8 (28-80)||(13265489-13265541)
chr8 (140-184)||(31885049-31885093)
chr8 (152-220)||(33714236-33714304)
chr8 (124-220)||(44426380-44426476)
chr8 (125-184)||(779034-779093)
chr8 (144-255)||(6509295-6509406)
chr8 (144-183)||(9835892-9835931)
chr8 (169-220)||(9956831-9956882)
chr8 (148-183)||(14949905-14949940)
chr8 (192-255)||(29205775-29205838)
chr8 (125-187)||(32840958-32841021)
chr8 (24-87)||(35285926-35285989)
chr8 (161-220)||(38874648-38874707)
chr8 (144-195)||(41606895-41606946)
chr8 (154-213)||(42215084-42215143)
chr8 (125-215)||(7918419-7918509)
chr8 (146-220)||(31705087-31705161)
chr8 (149-255)||(34849070-34849176)
chr8 (167-254)||(36338277-36338366)
chr8 (170-216)||(44236841-44236887)
chr8 (161-234)||(8062317-8062390)
chr8 (148-197)||(11183570-11183619)
chr8 (148-197)||(25869262-25869311)
chr8 (148-184)||(11118993-11119029)
chr8 (161-213)||(11494155-11494207)
chr8 (56-121)||(28879169-28879236)
chr8 (144-187)||(31751548-31751592)
chr8 (148-220)||(31875591-31875663)
chr8 (155-203)||(39866737-39866785)
[»] chr3 (91 HSPs)
chr3 (125-252)||(21367637-21367765)
chr3 (125-249)||(54837007-54837131)
chr3 (123-220)||(39602181-39602278)
chr3 (125-255)||(30443860-30443991)
chr3 (24-115)||(34707738-34707831)
chr3 (123-252)||(1217771-1217900)
chr3 (24-118)||(40581102-40581198)
chr3 (131-255)||(30573893-30574017)
chr3 (125-243)||(402514-402633)
chr3 (148-255)||(1816550-1816657)
chr3 (150-220)||(20669174-20669244)
chr3 (149-271)||(52618954-52619076)
chr3 (24-115)||(53218065-53218158)
chr3 (123-255)||(34610776-34610909)
chr3 (129-213)||(45541580-45541664)
chr3 (24-115)||(22809218-22809312)
chr3 (144-203)||(36139897-36139956)
chr3 (24-83)||(43079959-43080018)
chr3 (125-220)||(50600151-50600246)
chr3 (24-83)||(52421166-52421225)
chr3 (133-187)||(5391914-5391968)
chr3 (161-255)||(32095200-32095294)
chr3 (123-197)||(34954107-34954180)
chr3 (144-194)||(36101596-36101646)
chr3 (151-241)||(40665410-40665500)
chr3 (148-197)||(3044255-3044304)
chr3 (125-182)||(24624250-24624307)
chr3 (148-197)||(25925767-25925816)
chr3 (129-194)||(27290878-27290943)
chr3 (161-246)||(28622008-28622093)
chr3 (130-187)||(39723218-39723275)
chr3 (151-220)||(41633362-41633431)
chr3 (123-246)||(20880452-20880576)
chr3 (131-203)||(50952352-50952424)
chr3 (144-216)||(54180772-54180844)
chr3 (148-219)||(31010405-31010476)
chr3 (156-255)||(36783338-36783437)
chr3 (24-83)||(40240602-40240661)
chr3 (24-83)||(52021248-52021307)
chr3 (24-115)||(584988-585081)
chr3 (24-115)||(2086716-2086809)
chr3 (44-115)||(23555452-23555525)
chr3 (24-115)||(29270329-29270422)
chr3 (148-194)||(36200124-36200170)
chr3 (146-255)||(24785172-24785281)
chr3 (144-220)||(20192598-20192674)
chr3 (125-197)||(21574515-21574587)
chr3 (148-220)||(31710883-31710955)
chr3 (148-220)||(31711138-31711210)
chr3 (148-216)||(37273140-37273208)
chr3 (133-181)||(39723381-39723429)
chr3 (131-222)||(46030990-46031082)
chr3 (144-184)||(53762386-53762426)
chr3 (131-187)||(53952083-53952139)
chr3 (24-83)||(3870251-3870310)
chr3 (24-87)||(3876288-3876351)
chr3 (144-187)||(5166358-5166401)
chr3 (144-187)||(5396232-5396275)
chr3 (146-213)||(16790373-16790439)
chr3 (144-183)||(30923890-30923929)
chr3 (146-197)||(37825147-37825198)
chr3 (149-187)||(2128255-2128293)
chr3 (24-74)||(3845866-3845916)
chr3 (24-74)||(10521165-10521215)
chr3 (24-74)||(10667409-10667459)
chr3 (148-198)||(44374641-44374691)
chr3 (161-203)||(48991870-48991912)
chr3 (150-220)||(51130752-51130822)
chr3 (24-119)||(51409357-51409454)
chr3 (146-220)||(52440656-52440730)
chr3 (161-254)||(2719437-2719529)
chr3 (140-217)||(3845550-3845627)
chr3 (146-183)||(12923319-12923356)
chr3 (148-185)||(13804814-13804851)
chr3 (131-220)||(20502047-20502136)
chr3 (131-255)||(25453837-25453962)
chr3 (146-187)||(26599194-26599235)
chr3 (146-195)||(31403174-31403223)
chr3 (150-187)||(33883748-33883785)
chr3 (154-187)||(40321071-40321104)
chr3 (149-194)||(45432936-45432981)
chr3 (135-195)||(3015826-3015886)
chr3 (151-183)||(15096291-15096323)
chr3 (175-255)||(21335642-21335722)
chr3 (147-203)||(27787030-27787086)
chr3 (125-213)||(34254781-34254869)
chr3 (150-218)||(34924536-34924604)
chr3 (152-220)||(36887506-36887574)
chr3 (148-184)||(41724250-41724286)
chr3 (151-183)||(48048981-48049013)
chr3 (144-184)||(48300474-48300514)
[»] chr5 (101 HSPs)
chr5 (24-97)||(22201961-22202036)
chr5 (125-251)||(39105435-39105562)
chr5 (123-252)||(41957422-41957551)
chr5 (125-220)||(17258856-17258951)
chr5 (129-246)||(2568633-2568751)
chr5 (161-255)||(4014433-4014527)
chr5 (24-121)||(11163294-11163393)
chr5 (131-251)||(17368647-17368767)
chr5 (125-240)||(6587080-6587195)
chr5 (24-111)||(17128250-17128339)
chr5 (161-255)||(41981874-41981968)
chr5 (162-255)||(12425538-12425631)
chr5 (144-197)||(14331392-14331445)
chr5 (26-115)||(3520530-3520620)
chr5 (144-255)||(9202739-9202851)
chr5 (24-97)||(10537244-10537319)
chr5 (24-80)||(12467269-12467325)
chr5 (24-97)||(29922214-29922289)
chr5 (24-121)||(42851984-42852083)
chr5 (148-255)||(10272427-10272534)
chr5 (125-255)||(16937855-16937986)
chr5 (24-87)||(24030213-24030276)
chr5 (24-83)||(28625482-28625541)
chr5 (24-83)||(40452503-40452562)
chr5 (24-115)||(12987039-12987132)
chr5 (24-115)||(13060627-13060720)
chr5 (135-229)||(13604832-13604926)
chr5 (135-229)||(21768180-21768274)
chr5 (26-80)||(41534628-41534682)
chr5 (25-83)||(42706798-42706856)
chr5 (123-238)||(7984952-7985069)
chr5 (129-255)||(18857375-18857503)
chr5 (154-251)||(42582883-42582980)
chr5 (24-97)||(2670061-2670136)
chr5 (125-255)||(10639920-10640051)
chr5 (147-203)||(12521547-12521603)
chr5 (24-121)||(14243785-14243884)
chr5 (135-215)||(37611198-37611278)
chr5 (135-215)||(37787928-37788008)
chr5 (144-183)||(1899193-1899232)
chr5 (149-220)||(11707057-11707128)
chr5 (24-115)||(1372018-1372111)
chr5 (24-86)||(1473355-1473417)
chr5 (24-74)||(3977486-3977536)
chr5 (134-197)||(8089306-8089371)
chr5 (131-197)||(10125697-10125763)
chr5 (24-82)||(43268646-43268704)
chr5 (125-246)||(1619066-1619186)
chr5 (24-73)||(1868858-1868907)
chr5 (149-194)||(5284445-5284490)
chr5 (126-215)||(7674655-7674744)
chr5 (144-197)||(8177524-8177577)
chr5 (129-186)||(15405989-15406046)
chr5 (24-97)||(2878701-2878776)
chr5 (146-202)||(3504764-3504820)
chr5 (133-237)||(3977293-3977397)
chr5 (25-121)||(7364335-7364433)
chr5 (148-192)||(12467163-12467207)
chr5 (135-255)||(14295473-14295593)
chr5 (148-240)||(25461312-25461404)
chr5 (150-202)||(37690634-37690686)
chr5 (144-220)||(40205066-40205142)
chr5 (125-196)||(499704-499775)
chr5 (24-83)||(1943012-1943071)
chr5 (24-83)||(6144740-6144799)
chr5 (148-187)||(11700374-11700413)
chr5 (38-118)||(11991270-11991352)
chr5 (147-238)||(18543192-18543282)
chr5 (148-255)||(32172620-32172727)
chr5 (150-197)||(37526197-37526244)
chr5 (24-83)||(40697003-40697062)
chr5 (24-83)||(41059814-41059873)
chr5 (152-251)||(42583120-42583219)
chr5 (144-198)||(28413276-28413330)
chr5 (24-66)||(31637119-31637161)
chr5 (163-256)||(36318739-36318833)
chr5 (162-220)||(37588370-37588428)
chr5 (161-255)||(40426732-40426826)
chr5 (150-216)||(41052874-41052940)
chr5 (125-189)||(7808538-7808603)
chr5 (151-200)||(10303818-10303867)
chr5 (24-81)||(17657246-17657303)
chr5 (150-219)||(36638750-36638819)
chr5 (147-216)||(36639528-36639597)
chr5 (163-220)||(42582699-42582756)
chr5 (123-168)||(42646945-42646990)
chr5 (224-256)||(1295834-1295866)
chr5 (162-246)||(7319382-7319466)
chr5 (144-184)||(13264097-13264137)
chr5 (153-197)||(15074750-15074794)
chr5 (26-115)||(15413960-15414051)
chr5 (149-197)||(19138714-19138762)
chr5 (144-220)||(31723807-31723883)
chr5 (148-220)||(32194075-32194147)
chr5 (140-184)||(32703264-32703308)
chr5 (154-186)||(35036970-35037002)
chr5 (135-183)||(37794681-37794729)
chr5 (163-255)||(39594775-39594866)
chr5 (131-195)||(41112877-41112941)
chr5 (152-216)||(41225058-41225122)
chr5 (183-255)||(42646882-42646954)
[»] chr4 (92 HSPs)
chr4 (24-121)||(35124349-35124448)
chr4 (156-255)||(17884035-17884134)
chr4 (144-255)||(52746832-52746943)
chr4 (24-115)||(23297406-23297499)
chr4 (144-246)||(30066758-30066860)
chr4 (24-121)||(948034-948133)
chr4 (135-255)||(2996540-2996660)
chr4 (148-255)||(42685391-42685498)
chr4 (24-119)||(1374388-1374485)
chr4 (24-115)||(3564188-3564281)
chr4 (24-82)||(28074368-28074426)
chr4 (131-252)||(28300278-28300399)
chr4 (167-255)||(3155570-3155658)
chr4 (27-83)||(7148774-7148830)
chr4 (151-251)||(7694009-7694109)
chr4 (133-253)||(20936210-20936330)
chr4 (24-87)||(8130486-8130549)
chr4 (24-120)||(43699508-43699606)
chr4 (24-87)||(12495669-12495734)
chr4 (24-115)||(29877607-29877700)
chr4 (178-252)||(56480318-56480392)
chr4 (55-115)||(7148885-7148946)
chr4 (147-215)||(4798561-4798629)
chr4 (131-254)||(17822843-17822967)
chr4 (130-220)||(42641617-42641709)
chr4 (123-182)||(49939921-49939981)
chr4 (24-83)||(488409-488468)
chr4 (24-83)||(896972-897031)
chr4 (144-203)||(19304945-19305004)
chr4 (146-201)||(41606207-41606262)
chr4 (162-255)||(47800597-47800683)
chr4 (126-220)||(54426045-54426140)
chr4 (148-214)||(825486-825552)
chr4 (161-215)||(11802541-11802595)
chr4 (125-215)||(23819096-23819186)
chr4 (131-253)||(37863933-37864053)
chr4 (24-115)||(38345847-38345939)
chr4 (144-197)||(22236097-22236150)
chr4 (131-195)||(1137739-1137803)
chr4 (148-220)||(27721719-27721791)
chr4 (147-183)||(29467619-29467655)
chr4 (148-220)||(50800026-50800097)
chr4 (163-255)||(51630078-51630170)
chr4 (24-115)||(52700569-52700661)
chr4 (156-216)||(53673662-53673722)
chr4 (148-183)||(488122-488157)
chr4 (131-253)||(1706591-1706714)
chr4 (148-187)||(6978958-6978997)
chr4 (125-187)||(13126548-13126611)
chr4 (24-120)||(18424302-18424400)
chr4 (146-197)||(19422423-19422474)
chr4 (152-215)||(33534169-33534232)
chr4 (24-83)||(36740906-36740965)
chr4 (24-83)||(48591449-48591508)
chr4 (167-246)||(50004159-50004238)
chr4 (125-220)||(52754602-52754696)
chr4 (149-187)||(2980462-2980500)
chr4 (24-62)||(17222852-17222890)
chr4 (24-62)||(21216353-21216391)
chr4 (145-187)||(24747354-24747396)
chr4 (125-199)||(42461274-42461348)
chr4 (149-187)||(48719388-48719426)
chr4 (154-220)||(55084483-55084549)
chr4 (163-253)||(55302218-55302308)
chr4 (210-255)||(20108976-20109021)
chr4 (123-179)||(20719746-20719803)
chr4 (146-183)||(22684515-22684552)
chr4 (131-184)||(25571298-25571351)
chr4 (146-187)||(30024741-30024782)
chr4 (25-86)||(34526351-34526412)
chr4 (170-255)||(44138526-44138611)
chr4 (26-83)||(52274147-52274204)
chr4 (24-97)||(212973-213047)
chr4 (126-194)||(679746-679814)
chr4 (144-254)||(1407924-1408036)
chr4 (163-203)||(2592320-2592360)
chr4 (146-198)||(3646673-3646725)
chr4 (163-203)||(14011253-14011293)
chr4 (149-189)||(17223033-17223073)
chr4 (161-197)||(19429734-19429770)
chr4 (144-216)||(21043227-21043299)
chr4 (131-255)||(23459595-23459719)
chr4 (144-220)||(29263372-29263448)
chr4 (24-80)||(29615379-29615435)
chr4 (56-115)||(38345734-38345794)
chr4 (133-184)||(38515871-38515920)
chr4 (24-97)||(41228889-41228964)
chr4 (144-212)||(44249295-44249363)
chr4 (151-203)||(45927368-45927420)
chr4 (146-182)||(51555884-51555920)
chr4 (24-80)||(55638106-55638162)
chr4 (125-185)||(56249561-56249621)
[»] chr6 (68 HSPs)
chr6 (123-253)||(20368151-20368281)
chr6 (128-220)||(31624092-31624184)
chr6 (24-87)||(8014786-8014849)
chr6 (149-255)||(29296292-29296396)
chr6 (149-213)||(4420652-4420716)
chr6 (146-278)||(8420191-8420323)
chr6 (24-115)||(25430791-25430881)
chr6 (133-255)||(2735036-2735159)
chr6 (144-203)||(7785736-7785795)
chr6 (131-194)||(13908491-13908554)
chr6 (146-216)||(6647393-6647463)
chr6 (146-255)||(9093549-9093659)
chr6 (125-203)||(28641722-28641800)
chr6 (130-187)||(696637-696694)
chr6 (151-220)||(4246412-4246481)
chr6 (24-122)||(7267736-7267836)
chr6 (161-245)||(35070476-35070560)
chr6 (148-255)||(281844-281951)
chr6 (24-83)||(2034254-2034313)
chr6 (24-87)||(3211026-3211089)
chr6 (148-215)||(9667981-9668048)
chr6 (24-83)||(21025252-21025311)
chr6 (24-87)||(30533978-30534041)
chr6 (149-187)||(821834-821872)
chr6 (146-216)||(3168255-3168325)
chr6 (125-275)||(4006661-4006811)
chr6 (148-194)||(9027606-9027652)
chr6 (123-229)||(10616512-10616618)
chr6 (125-187)||(34404698-34404760)
chr6 (144-241)||(34430452-34430550)
chr6 (130-187)||(1575930-1575987)
chr6 (144-181)||(3775120-3775157)
chr6 (131-203)||(9912169-9912242)
chr6 (131-252)||(33089476-33089597)
chr6 (133-181)||(696483-696531)
chr6 (125-185)||(769175-769235)
chr6 (26-74)||(1240638-1240686)
chr6 (24-84)||(2027201-2027261)
chr6 (151-251)||(8364975-8365075)
chr6 (31-83)||(10755312-10755364)
chr6 (146-254)||(27894015-27894122)
chr6 (162-254)||(31776285-31776377)
chr6 (144-183)||(2027398-2027437)
chr6 (144-183)||(2034438-2034477)
chr6 (148-203)||(3528822-3528877)
chr6 (171-254)||(6654583-6654666)
chr6 (24-83)||(10054383-10054442)
chr6 (125-184)||(10616686-10616745)
chr6 (24-79)||(24625857-24625912)
chr6 (150-197)||(27909636-27909683)
chr6 (168-255)||(31671090-31671177)
chr6 (130-187)||(1575785-1575843)
chr6 (144-182)||(3201939-3201977)
chr6 (148-194)||(6536975-6537021)
chr6 (131-220)||(103433-103522)
chr6 (150-255)||(415271-415376)
chr6 (148-197)||(3155201-3155249)
chr6 (148-197)||(7148691-7148740)
chr6 (164-213)||(31624953-31625002)
chr6 (144-197)||(34939769-34939822)
chr6 (163-195)||(323599-323631)
chr6 (168-220)||(835265-835317)
chr6 (24-97)||(6758613-6758688)
chr6 (36-121)||(9201768-9201855)
chr6 (66-115)||(11795528-11795579)
chr6 (24-121)||(21891363-21891462)
chr6 (131-187)||(33832252-33832308)
chr6 (125-220)||(34910381-34910477)
[»] chr7 (77 HSPs)
chr7 (26-115)||(38372526-38372617)
chr7 (24-115)||(26331779-26331872)
chr7 (25-115)||(30181518-30181610)
chr7 (146-253)||(39907772-39907878)
chr7 (125-255)||(48470011-48470142)
chr7 (162-251)||(44821930-44822019)
chr7 (135-255)||(12110327-12110447)
chr7 (163-255)||(20526413-20526505)
chr7 (24-97)||(44613498-44613573)
chr7 (130-254)||(752935-753061)
chr7 (149-216)||(7244686-7244753)
chr7 (148-218)||(529379-529449)
chr7 (25-87)||(34922929-34922991)
chr7 (24-115)||(40629442-40629534)
chr7 (162-255)||(22283754-22283847)
chr7 (130-187)||(43219622-43219679)
chr7 (134-203)||(43250681-43250750)
chr7 (145-253)||(8094239-8094347)
chr7 (135-203)||(46082055-46082123)
chr7 (24-115)||(29390575-29390668)
chr7 (146-220)||(47559595-47559669)
chr7 (146-187)||(6552286-6552327)
chr7 (130-187)||(11048062-11048119)
chr7 (130-187)||(15740389-15740446)
chr7 (131-255)||(39967887-39968012)
chr7 (144-220)||(425816-425892)
chr7 (124-255)||(33678747-33678879)
chr7 (148-184)||(39539777-39539813)
chr7 (133-181)||(43219785-43219833)
chr7 (144-255)||(3610732-3610843)
chr7 (24-83)||(6406897-6406956)
chr7 (125-220)||(6601369-6601464)
chr7 (129-216)||(9038118-9038204)
chr7 (148-195)||(12234885-12234932)
chr7 (144-255)||(28165058-28165169)
chr7 (24-83)||(29378647-29378706)
chr7 (147-198)||(29768634-29768685)
chr7 (148-183)||(36598352-36598387)
chr7 (154-241)||(38010695-38010782)
chr7 (24-83)||(41037755-41037813)
chr7 (149-220)||(44151477-44151548)
chr7 (148-187)||(44808193-44808232)
chr7 (164-243)||(46280284-46280363)
chr7 (24-83)||(47511045-47511104)
chr7 (148-255)||(48157116-48157223)
chr7 (125-203)||(3836656-3836733)
chr7 (144-182)||(12834954-12834992)
chr7 (130-187)||(15740533-15740591)
chr7 (131-181)||(19719047-19719097)
chr7 (144-198)||(22551397-22551451)
chr7 (144-186)||(25130081-25130123)
chr7 (148-218)||(26935553-26935623)
chr7 (161-255)||(39279929-39280023)
chr7 (161-255)||(40688995-40689089)
chr7 (149-199)||(45901176-45901226)
chr7 (161-254)||(5947153-5947245)
chr7 (149-222)||(9423591-9423664)
chr7 (167-220)||(12792578-12792631)
chr7 (144-213)||(25596042-25596111)
chr7 (133-198)||(25670567-25670632)
chr7 (34-83)||(33288134-33288183)
chr7 (146-215)||(35267369-35267438)
chr7 (170-243)||(45338428-45338500)
chr7 (139-195)||(5628554-5628609)
chr7 (177-261)||(15309590-15309674)
chr7 (144-251)||(17944334-17944442)
chr7 (144-220)||(18749809-18749885)
chr7 (24-87)||(20888571-20888635)
chr7 (148-203)||(21247944-21248000)
chr7 (152-220)||(24363601-24363669)
chr7 (151-183)||(27496406-27496438)
chr7 (151-183)||(27503064-27503096)
chr7 (131-187)||(30535598-30535654)
chr7 (135-183)||(33894666-33894714)
chr7 (24-80)||(41094223-41094279)
chr7 (148-192)||(47134753-47134797)
chr7 (168-220)||(48917362-48917414)
[»] chr2 (96 HSPs)
chr2 (152-219)||(19333325-19333392)
chr2 (125-255)||(16451092-16451216)
chr2 (123-255)||(8017401-8017533)
chr2 (124-195)||(1647263-1647334)
chr2 (24-87)||(25836737-25836800)
chr2 (125-202)||(28677632-28677709)
chr2 (133-262)||(33941869-33941998)
chr2 (131-246)||(26626849-26626965)
chr2 (162-246)||(33319822-33319906)
chr2 (135-215)||(35378999-35379079)
chr2 (26-120)||(38215986-38216078)
chr2 (131-235)||(41817155-41817259)
chr2 (24-83)||(887414-887473)
chr2 (24-115)||(2790095-2790189)
chr2 (125-184)||(5902522-5902581)
chr2 (164-255)||(12464485-12464576)
chr2 (133-251)||(18066099-18066218)
chr2 (144-255)||(29316767-29316878)
chr2 (161-252)||(40279167-40279258)
chr2 (144-242)||(680483-680581)
chr2 (131-181)||(787373-787423)
chr2 (146-251)||(1625871-1625977)
chr2 (125-255)||(12313146-12313276)
chr2 (125-187)||(44606083-44606145)
chr2 (24-118)||(4026891-4026986)
chr2 (146-195)||(5781696-5781745)
chr2 (162-255)||(9395097-9395190)
chr2 (129-218)||(33192206-33192295)
chr2 (142-195)||(33942177-33942230)
chr2 (148-213)||(34652032-34652097)
chr2 (148-216)||(1939328-1939396)
chr2 (163-255)||(4026784-4026876)
chr2 (24-97)||(33321337-33321412)
chr2 (24-97)||(34913415-34913490)
chr2 (132-220)||(40158720-40158808)
chr2 (175-255)||(41875676-41875756)
chr2 (123-254)||(1742003-1742134)
chr2 (148-255)||(6227718-6227825)
chr2 (148-239)||(33931566-33931657)
chr2 (131-218)||(35378511-35378598)
chr2 (24-63)||(39592271-39592310)
chr2 (125-187)||(33256775-33256837)
chr2 (24-111)||(33321428-33321517)
chr2 (131-237)||(42419982-42420088)
chr2 (146-183)||(5826256-5826293)
chr2 (148-233)||(7871632-7871717)
chr2 (148-220)||(9174817-9174890)
chr2 (144-241)||(10563550-10563647)
chr2 (144-197)||(27237885-27237938)
chr2 (123-187)||(41293133-41293198)
chr2 (162-255)||(42457915-42458008)
chr2 (148-220)||(1893277-1893349)
chr2 (132-184)||(2091014-2091066)
chr2 (161-253)||(3611195-3611287)
chr2 (29-110)||(4090462-4090545)
chr2 (149-185)||(10285392-10285428)
chr2 (144-216)||(10567063-10567135)
chr2 (135-186)||(1494429-1494480)
chr2 (24-87)||(11776982-11777045)
chr2 (25-80)||(13056353-13056408)
chr2 (148-215)||(15120190-15120257)
chr2 (168-215)||(15977992-15978039)
chr2 (154-241)||(22681187-22681274)
chr2 (144-207)||(25790141-25790204)
chr2 (145-220)||(32364724-32364799)
chr2 (125-168)||(40776070-40776113)
chr2 (144-183)||(44438831-44438870)
chr2 (144-194)||(8820284-8820334)
chr2 (149-203)||(11307331-11307385)
chr2 (161-203)||(24098121-24098163)
chr2 (123-181)||(29430799-29430857)
chr2 (24-86)||(29774744-29774806)
chr2 (24-62)||(36501540-36501578)
chr2 (161-255)||(41241141-41241235)
chr2 (148-246)||(43910995-43911093)
chr2 (145-235)||(43984996-43985086)
chr2 (144-241)||(656769-656866)
chr2 (142-187)||(4326383-4326428)
chr2 (146-183)||(6547941-6547978)
chr2 (146-203)||(12147476-12147533)
chr2 (163-220)||(16398116-16398173)
chr2 (156-220)||(18836464-18836529)
chr2 (226-255)||(33981104-33981133)
chr2 (146-183)||(35538685-35538722)
chr2 (146-183)||(35557119-35557156)
chr2 (125-212)||(750680-750768)
chr2 (150-186)||(9875463-9875499)
chr2 (156-220)||(10884525-10884589)
chr2 (24-87)||(11072943-11073007)
chr2 (148-255)||(15377732-15377840)
chr2 (170-222)||(26143658-26143710)
chr2 (148-216)||(36852478-36852546)
chr2 (145-197)||(38809351-38809403)
chr2 (225-261)||(43199866-43199902)
chr2 (133-193)||(43717117-43717177)
chr2 (149-213)||(44443330-44443394)
[»] scaffold0157 (1 HSPs)
scaffold0157 (24-87)||(24743-24808)
[»] scaffold0159 (1 HSPs)
scaffold0159 (146-195)||(27028-27077)
[»] scaffold0057 (2 HSPs)
scaffold0057 (25-118)||(43842-43937)
scaffold0057 (28-87)||(24418-24476)
[»] scaffold0608 (1 HSPs)
scaffold0608 (131-186)||(9616-9671)
[»] scaffold0024 (2 HSPs)
scaffold0024 (24-83)||(97231-97290)
scaffold0024 (146-255)||(27543-27652)
[»] scaffold0003 (1 HSPs)
scaffold0003 (144-195)||(306353-306404)
[»] scaffold0221 (1 HSPs)
scaffold0221 (163-253)||(22200-22290)
[»] scaffold0072 (1 HSPs)
scaffold0072 (134-183)||(4998-5047)
[»] scaffold0004 (1 HSPs)
scaffold0004 (146-183)||(98634-98671)
[»] scaffold0041 (1 HSPs)
scaffold0041 (24-80)||(109017-109073)


Alignment Details
Target: chr1 (Bit Score: 519; Significance: 0; HSPs: 112)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 519; E-Value: 0
Query Start/End: Original strand, 24 - 569
Target Start/End: Original strand, 1565407 - 1565952
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgtttcataagctcagaagtaagtcaatccaaatgggccgt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1565407 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgtttcataagctcagaagtaagtcaatccaaatgggccgt 1565506  T
124 atttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacac 223  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1565507 atttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacac 1565606  T
224 tttatacaaaaacaatttaacttcattttatcacttatattagaaatatcttgtatacataaacacttggtaactataagctgcaatgaacaataaactt 323  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1565607 tttatacaaaaacaatttaacttcattttatcacttatattagaaatatcttgtatacataaacacttggtaactataagctgcaatgaacaataaactt 1565706  T
324 caatgataacgcaaaacacagcaagaatgctnnnnnnnnncgtacaatctcaggtgagtacttgcggaaaggtatacaaacaccacgctcaatgtcaagc 423  Q
    |||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1565707 caatgataacgcaaaacacagcaagaatgctaaaaaaaaacgtacaatctcaggtgagtacttgcggaaaggtatacaaacaccacgctcaatgtcaagc 1565806  T
424 tgctccaacgcactgttattcgactttgaattactaggcagctgcaacggcctcacaaccgcgccgtttccagtggtcgaagccaaattcgaaattcgca 523  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1565807 tgctccaacgcactgttattcgactttgaattactaggcagctgcaacggcctcacaaccgcgccgtttccagtggtcgaagccaaattcgaaattcgca 1565906  T
524 ctctccgcactttcctctgctcgattctgggcgagagagtcaattg 569  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
1565907 ctctccgcactttcctctgctcgattctgggcgagagagtcaattg 1565952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 144 - 220
Target Start/End: Complemental strand, 6292571 - 6292495
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||| ||||| ||||||    
6292571 acagcttatgacatgttcataagctgttttcagcttattttcataagctctccaaaatagtttacgaaaatagctta 6292495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 125 - 255
Target Start/End: Original strand, 31517713 - 31517843
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacact 224  Q
    ||||| ||||||||  || ||| || ||||||||| ||||||||||||||||||||||||||| |||||||||| | |||||| ||| |||||||| |      
31517713 tttgggagaacttatcaaaacaactcatgacatgttcataagctgttttcagcttattttcataagctctccaagacagattatgaagacagcttatagc 31517812  T
225 ttatacaaaaacaatttaacttcattttatc 255  Q
    |||||  ||| ||||||||||| ||||||||    
31517813 ttatatgaaatcaatttaactttattttatc 31517843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 150 - 246
Target Start/End: Complemental strand, 7472384 - 7472287
Alignment:
150 tatgacatgtgcataag-ctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaactt 246  Q
    |||||||||| |||||  ||||||||||||||||||||| |||||||||| |||| ||| | |||||||||| |  ||||||||||||||||||||||    
7472384 tatgacatgttcataaaactgttttcagcttattttcataagctctccaagatagcttatggaaacagcttatagattatacaaaaacaatttaactt 7472287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 10199379 - 10199476
Alignment:
123 tatttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||| |||||| | ||| | |||||||||||||| |||||| |||||||||||||||||||| ||||||| ||||||| ||| ||||| ||||||    
10199379 tatttgggagaactcatgaaaatagcttatgacatgttcataagttgttttcagcttattttcataagctctctaaaatagcttatgaaaaaagctta 10199476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 24 - 121
Target Start/End: Original strand, 26946129 - 26946229
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaa-gcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatgggc 120  Q
    ||||||||||||| ||||||||| ||||||  ||||||| |||| ||||||||||||||| ||||  |||||||||| || |||||||||||||||||||    
26946129 cataaactaccttaacaagcttatgaataacacataaaaagcttatttatttacataagccgttttgcataagctcaaaaataagtcaatccaaatgggc 26946228  T
121 c 121  Q
    |    
26946229 c 26946229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 6337781 - 6337840
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||    
6337781 cataaactaccttgacaagcttatgaataatacataaaagcttatttatttacataagct 6337840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 131 - 229
Target Start/End: Complemental strand, 37811943 - 37811845
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttata 229  Q
    |||||||| ||| |||||||||||||||| ||||| ||||||||| ||||||| ||| |||||||||  || | ||| |||||||||||||| ||||||    
37811943 agaacttatgaaaacagcttatgacatgttcataaactgttttcaacttatttccattagctctccatgatggcttatgaaaacagcttacaatttata 37811845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 146 - 255
Target Start/End: Complemental strand, 34290312 - 34290203
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaact 245  Q
    |||||||||||| | |||||| |||||||||||||||||||| || ||| ||| |||| ||| |||||||||||| |  ||||||||||  || ||||||    
34290312 agcttatgacatattcataagttgttttcagcttattttcataagttcttcaagatagcttatgaaaacagcttatagcttatacaaaataaaattaact 34290213  T
246 tcattttatc 255  Q
    | ||||||||    
34290212 ttattttatc 34290203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 148 - 212
Target Start/End: Original strand, 37593680 - 37593744
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaa 212  Q
    |||||||||||| ||||||||||||||||||||||||||| |||||| |||||||| ||| ||||    
37593680 cttatgacatgttcataagctgttttcagcttattttcataagctcttcaaaatagcttatgaaa 37593744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 124 - 195
Target Start/End: Original strand, 11639388 - 11639459
Alignment:
124 atttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctc 195  Q
    |||| ||||| |||| ||| |||||||||||||||| ||||||||||||| ||||||||||||| |||||||    
11639388 atttagaagagcttatgaaaacagcttatgacatgtccataagctgtttttagcttattttcataagctctc 11639459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 125 - 235
Target Start/End: Original strand, 7136971 - 7137081
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacact 224  Q
    |||| ||||||||| ||| |  ||||||||||| | |||||| | |||||||||||||||||| || ||||||| |||| ||| |||||||||||| |      
7136971 tttgaaagaacttatgaaaatcgcttatgacatattcataagttattttcagcttattttcataagttctccaagatagcttatgaaaacagcttataga 7137070  T
225 ttatacaaaaa 235  Q
    |||||||||||    
7137071 ttatacaaaaa 7137081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 144 - 242
Target Start/End: Complemental strand, 43332562 - 43332464
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaattta 242  Q
    |||||||||||| |||   ||| |||||||||||||||||| || |||||| ||| |||| ||| ||||||||||||||  |||||||||| |||||||    
43332562 acagcttatgacctgtttctaacctgttttcagcttattttaataagctcttcaagatagcttatgaaaacagcttacaacttatacaaaaccaattta 43332464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 144 - 220
Target Start/End: Complemental strand, 27140556 - 27140480
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||||||||| |||||| |||||||||||||||| ||| |||||||||  |||| |||  |||||||||||    
27140556 acagcttatgacatgtccataagttgttttcagcttatttgcataagctctccatgatagcttataaaaacagctta 27140480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 131 - 203
Target Start/End: Original strand, 28689431 - 28689503
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    |||||||| | | |||||||||||||||| |||||| |||||||||||||||||||| |||| ||||| ||||    
28689431 agaacttacggaaacagcttatgacatgtccataagttgttttcagcttattttcataagctttccaagatag 28689503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 146 - 246
Target Start/End: Original strand, 41195187 - 41195287
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaact 245  Q
    |||||||||||| |  ||||||| |||||||||||||||||| || ||||||| |||| ||| |||||||| | | | | |||||||||||| |||||||    
41195187 agcttatgacattttaataagcttttttcagcttattttcataagttctccaagatagtttatgaaaacagttgatagtatatacaaaaacagtttaact 41195286  T
246 t 246  Q
    |    
41195287 t 41195287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 4068176 - 4068117
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| ||||||| || |||||    
4068176 cataaactaccttgacaagcttatgaataatacataaaagcttatttatttgcacaagct 4068117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 87
Target Start/End: Complemental strand, 18327585 - 18327522
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt 87  Q
    ||||||||| ||||||||||||| || |||| ||||||||||| ||||||| ||||||||||||    
18327585 cataaactatcttgacaagcttatgagtaatacataaaagcttatttatttgcataagctgttt 18327522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 59 - 115
Target Start/End: Complemental strand, 26946073 - 26946015
Alignment:
59 aaaagcttgtttatttacataagctg--tttcataagctcagaagtaagtcaatccaaa 115  Q
    ||||||||||||||||||||||||||  ||||||||||||| || ||||||||||||||    
26946073 aaaagcttgtttatttacataagctgattttcataagctcaaaaataagtcaatccaaa 26946015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 161 - 255
Target Start/End: Original strand, 24915060 - 24915154
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattttatc 255  Q
    |||||||| |||||| ||||||||||  || ||||||| | || ||| |||||||||||| |   ||||||||||||||||||||| ||||||||    
24915060 cataagcttttttcaacttattttcacaagttctccaagacagcttatgaaaacagcttatagcatatacaaaaacaatttaactttattttatc 24915154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 43338215 - 43338141
Alignment:
123 tatttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    ||||| |||||||||| | | |||||||||||||||| ||||| || |||||||| ||||||||| |||||||||    
43338215 tatttagaagaacttatggaaacagcttatgacatgttcataatctattttcagcctattttcataagctctcca 43338141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 161 - 246
Target Start/End: Complemental strand, 2294972 - 2294887
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaactt 246  Q
    ||||||||||||||| ||||||||| | || ||||||| |||| ||| ||||| |||||| |  |||| |||||||||||||||||    
2294972 cataagctgttttcaccttattttcgtaagttctccaagatagtttatgaaaatagcttatagcttatccaaaaacaatttaactt 2294887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 24 - 73
Target Start/End: Original strand, 15515372 - 15515421
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatt 73  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| ||||||    
15515372 cataaactaccttgacaagcttatgaataatacataaaagcttatttatt 15515421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 26184826 - 26184773
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    |||||||||||||||| |||||||||||||||| |||||| ||| |||||||||    
26184826 acagcttatgacatgtccataagctgttttcagattatttccataagctctcca 26184773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 24 - 114
Target Start/End: Complemental strand, 35590191 - 35590099
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaa 114  Q
    ||||||| ||||||||||||||| |||  || ||||||||||| ||||||| |||||| |||||  |||||||| | || |||||||||||||    
35590191 cataaacaaccttgacaagcttatgaactatacataaaagcttatttatttgcataagttgttttacataagctaaaaaataagtcaatccaa 35590099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 132 - 197
Target Start/End: Complemental strand, 35925780 - 35925715
Alignment:
132 gaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    ||||||| ||| |||||||||||||||| ||||||||||||||| ||||||| ||| | |||||||    
35925780 gaacttatgaaaacagcttatgacatgttcataagctgttttcaacttatttccataaactctcca 35925715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 148 - 220
Target Start/End: Complemental strand, 4622167 - 4622095
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||||| ||||||||||||| ||||||||||||  |||||||||| ||||  || | ||||||||||    
4622167 cttatgacatgtccataagctgtttttagcttattttcacaagctctccaagatagcatatggaaacagctta 4622095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 27963362 - 27963438
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||||||||| |||||| |||||| |||||||||  || ||||||||| ||||| ||| ||||||| ||||    
27963362 acagcttatgacatgtccataagttgtttttagcttatttatataagctctccataatagcttatgaaaacaactta 27963438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 144 - 219
Target Start/End: Original strand, 4202143 - 4202218
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctt 219  Q
    |||||||||||||||| |||||||| |||||||||||||||| | |||||| | | |||| ||  |||||||||||    
4202143 acagcttatgacatgtccataagctattttcagcttattttcgtaagctctgccagatagcttttgaaaacagctt 4202218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 125 - 220
Target Start/End: Complemental strand, 10744398 - 10744303
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||| |||||||  ||| |||||||||| ||||| ||||||||||||||| |||||||| || || |||| || | || ||| ||||||||||||    
10744398 tttgggagaacttgtgaaaacagcttatggcatgttcataagctgttttcatcttatttttataagttctctaagacagcttatgaaaacagctta 10744303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 144 - 203
Target Start/End: Complemental strand, 11695939 - 11695880
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    |||| ||||||||||| ||||||||||||||| ||||||||||| |||| |||| |||||    
11695939 acagtttatgacatgtccataagctgttttcaacttattttcataagctttccagaatag 11695880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 148 - 255
Target Start/End: Complemental strand, 17628673 - 17628566
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttc 247  Q
    |||||||||||| ||||||||||||||||| ||||| ||  ||  ||||||||||| | |  ||||||||||| | ||||||  |||||||||| ||||     
17628673 cttatgacatgtccataagctgttttcagcatatttccaaaagacctccaaaatagttaataaaaacagcttataatttatatgaaaacaatttgacttt 17628574  T
248 attttatc 255  Q
    | ||||||    
17628573 actttatc 17628566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 161 - 220
Target Start/End: Complemental strand, 35179200 - 35179141
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||||||||||||||||||| || |||||| ||||  ||| ||||||||||||    
35179200 cataagctgttttcagcttattttcataagttctccataataacttatgaaaacagctta 35179141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 164 - 255
Target Start/End: Original strand, 37631571 - 37631662
Alignment:
164 aagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattttatc 255  Q
    ||||| |||||||||||||||||| || ||||||| |||| |||  ||||||||| | |   || |||||||||||||| ||||||||||||    
37631571 aagcttttttcagcttattttcataagttctccaatatagcttacaaaaacagctaatatcatacacaaaaacaatttagcttcattttatc 37631662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 148 - 203
Target Start/End: Original strand, 46252678 - 46252733
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    |||||||||||| |||||| ||||||||| |||||||||| |||||||||| ||||    
46252678 cttatgacatgttcataagttgttttcaggttattttcataagctctccaagatag 46252733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 48819360 - 48819301
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| ||||||| ||| ||||||  ||||||| ||||||||    
48819360 cataaactaccttgacaagcttatgaataatacattaaagctcatttatttgcataagct 48819301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 24 - 74
Target Start/End: Complemental strand, 26988209 - 26988159
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttattt 74  Q
    ||||||||||||||||||||||| ||||||  ||||||||||| |||||||    
26988209 cataaactaccttgacaagcttatgaataagacataaaagcttatttattt 26988159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 24 - 115
Target Start/End: Complemental strand, 37712128 - 37712036
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctg--tttcataagctcagaagtaagtcaatccaaa 115  Q
    ||||||||||||||||||||||| |||| || ||||||||||| || |||| ||||| |||  |||||| |||||| || ||| ||||||||||    
37712128 cataaactaccttgacaagcttatgaat-atacataaaagcttattcatttgcataaactgtttttcattagctcaaaaataaatcaatccaaa 37712036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 125 - 183
Target Start/End: Complemental strand, 45394212 - 45394154
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattt 183  Q
    |||||||||||||| ||| ||||||||||| ||||  |||||||||||||| |||||||    
45394212 tttggaagaacttaagaaaacagcttatgagatgtcgataagctgttttcaacttattt 45394154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 161 - 235
Target Start/End: Complemental strand, 45975751 - 45975677
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaa 235  Q
    ||||||||||||||||||||||||||| |  ||||||| |||| ||| |||||||||||  |  |||||||||||    
45975751 cataagctgttttcagcttattttcataaattctccaagatagcttatgaaaacagcttgtagcttatacaaaaa 45975677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 148 - 253
Target Start/End: Original strand, 7218070 - 7218175
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttc 247  Q
    ||||||||| || || |||||||||||| ||||||||||| || ||||||  |||| ||| ||||||| |||| |  |||||  |||||||||| ||||     
7218070 cttatgacacgttcacaagctgttttcaacttattttcataagttctccaggataggttatgaaaacaacttatagcttatatgaaaacaatttgacttt 7218169  T
248 atttta 253  Q
    ||||||    
7218170 atttta 7218175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 148 - 205
Target Start/End: Complemental strand, 8016331 - 8016274
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagat 205  Q
    |||||||||||| |||||  |||||||||||||||||| | |||||||||| ||||||    
8016331 cttatgacatgttcataacttgttttcagcttattttcctaagctctccaagatagat 8016274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 144 - 185
Target Start/End: Complemental strand, 10854811 - 10854770
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttc 185  Q
    |||||||||||||||| || ||||||||||||||||||||||    
10854811 acagcttatgacatgttcacaagctgttttcagcttattttc 10854770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 161 - 254
Target Start/End: Original strand, 27820346 - 27820439
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattttat 254  Q
    |||||||| |||||||||||||||||| |  ||||||| |||| |||  |||||||| || |  ||||||| |||||||||| ||| |||||||    
27820346 cataagctattttcagcttattttcataaattctccaagatagcttataaaaacagcatatagcttatacataaacaatttagctttattttat 27820439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 131 - 220
Target Start/End: Original strand, 37842334 - 37842423
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||| ||| ||| || ||||||||| ||||||| |||||||||||||||| || || ||| ||| |||| ||| ||||||| ||||    
37842334 agaacttatgaaaacatctaatgacatgttcataagcagttttcagcttatttttataagttcttcaagatagcttatgaaaacaactta 37842423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 126 - 199
Target Start/End: Original strand, 38170664 - 38170737
Alignment:
126 ttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaa 199  Q
    |||| ||| |||| ||| |||||||||||||||| |||||| |||||||||||| ||||| | |||||| ||||    
38170664 ttgggagagcttatgaaaacagcttatgacatgttcataagttgttttcagcttgttttcctaagctcttcaaa 38170737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 146 - 203
Target Start/End: Original strand, 44815297 - 44815354
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    ||||||||| ||||| ||||  |||||||||||||||| ||| |||||||||||||||    
44815297 agcttatgatatgtgtataaattgttttcagcttatttccataagctctccaaaatag 44815354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 29 - 121
Target Start/End: Complemental strand, 391225 - 391130
Alignment:
29 actaccttgacaagcttacgaataatgcataaaa-gcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatgggcc 121  Q
    ||||| |||||||||||| |||||||  |||||| |||| ||||||| ||||||||||||  ||||| |||| || |||| ||||||||| |||||    
391225 actacattgacaagcttatgaataatatataaaaagcttatttatttgcataagctgttttgcataacctcaaaaataagccaatccaaacgggcc 391130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 125 - 196
Target Start/End: Original strand, 3887604 - 3887676
Alignment:
125 tttggaagaacttaggaagacagcttatgaca-tgtgcataagctgttttcagcttattttcatgagctctcc 196  Q
    |||||||||||||| ||| ||| ||||||||| ||| ||||||||||||| | ||||||||||| || |||||    
3887604 tttggaagaacttatgaaaacatcttatgacattgttcataagctgtttttaacttattttcataagttctcc 3887676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 24 - 80
Target Start/End: Original strand, 37329437 - 37329493
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataa 80  Q
    ||||||||||||||||||| ||| ||||||| ||||||||||  ||||||| |||||    
37329437 cataaactaccttgacaagtttatgaataatacataaaagctcatttatttgcataa 37329493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 125 - 185
Target Start/End: Original strand, 42757150 - 42757210
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttc 185  Q
    |||||||||||||| ||| ||| ||||| |||| | ||||||||||||||||||| |||||    
42757150 tttggaagaacttacgaaaacaacttattacatattcataagctgttttcagctttttttc 42757210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 148 - 187
Target Start/End: Original strand, 1509961 - 1510000
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcat 187  Q
    |||||||||||| ||| |||||||||||||||||||||||    
1509961 cttatgacatgttcattagctgttttcagcttattttcat 1510000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 3069879 - 3069938
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| ||||||| ||| |||||||  ||||||  |||||||    
3069879 cataaactaccttgacaagcttatgaataatacattaaagcttacttatttgtataagct 3069938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 131 - 186
Target Start/End: Complemental strand, 4482021 - 4481966
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttca 186  Q
    |||||||| ||| ||| ||||| |||||| ||||||||||||| ||||||||||||    
4482021 agaacttatgaaaacaacttattacatgttcataagctgtttttagcttattttca 4481966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 147 - 198
Target Start/End: Original strand, 5886989 - 5887040
Alignment:
147 gcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaa 198  Q
    ||||||||||||| |||||| |||||||||||||||||| | || |||||||    
5886989 gcttatgacatgttcataagttgttttcagcttattttcgtaagttctccaa 5887040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 252
Target Start/End: Complemental strand, 10809426 - 10809315
Alignment:
141 aagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatt 240  Q
    |||||| ||||||||||||  ||||  |||||||||||||||||||| || ||||||| |||| | | || |||| |||| |  ||| ||||||| | ||    
10809426 aagacaacttatgacatgtttataatatgttttcagcttattttcataagttctccaatatagctgatgagaacaacttatagcttacacaaaaatactt 10809327  T
241 taacttcatttt 252  Q
    |||||| |||||    
10809326 taactttatttt 10809315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 25479654 - 25479583
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||| ||| || |||||||||||||||||||| ||||||| |  |||| ||| ||||||| ||||    
25479654 ttatgacatgttcattagttgttttcagcttattttcataagctctctaggatagcttatgaaaacaactta 25479583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 24 - 121
Target Start/End: Complemental strand, 28690065 - 28689964
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagct--tgtttatttacataagctgt--ttcataagctcagaagtaagtcaatccaaatggg 119  Q
    |||||||||||||||||| |||| ||||||| ||||||| ||  | ||||||| ||||||||||  | ||||| || | || |||| |||||||||||||    
28690065 cataaactaccttgacaaacttatgaataatacataaaaccttatatttatttgcataagctgttctgcataaactaaaaaataagccaatccaaatggg 28689966  T
120 cc 121  Q
    ||    
28689965 cc 28689964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 30257756 - 30257685
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||| |||||||||||||||||||||||  || ||| |||||  |||| ||| ||||||| ||||    
30257756 ttatgacatgttcataagctgttttcagcttatttctataagccctccaggatagtttatgaaaacaactta 30257685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 144 - 187
Target Start/End: Original strand, 30815645 - 30815688
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcat 187  Q
    |||||||||||||||| |||||  ||||||||||||||||||||    
30815645 acagcttatgacatgttcataaaatgttttcagcttattttcat 30815688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 31378776 - 31378835
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||   ||||||  |||||||||| ||||||| ||||||||    
31378776 cataaactaccttgacaagcttgttaataatatataaaagcttatttatttgcataagct 31378835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 144 - 255
Target Start/End: Original strand, 36151497 - 36151608
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaa 243  Q
    |||| ||||||||||| ||||| ||||||||| ||||||||||| ||||| | |  || | ||| |||||||  ||| |  |||||| |||||||||| |    
36151497 acagtttatgacatgtccataacctgttttcaacttattttcataagctcactaggattgtttacgaaaacaatttataacttatacgaaaacaatttga 36151596  T
244 cttcattttatc 255  Q
    ||| ||||||||    
36151597 ctttattttatc 36151608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 36423006 - 36423065
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||| |||| |||| |||||||  |||||||||| ||||||| ||||||||    
36423006 cataaactaccttaacaaacttatgaataataaataaaagcttatttatttgcataagct 36423065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 41130055 - 41129996
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||| |||| || ||||||| ||||||| ||||||| ||| ||||||||||||||||    
41130055 cataaaccacctagagaagcttatgaataatacataaaaacttttttatttacataagct 41129996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 146 - 197
Target Start/End: Complemental strand, 44422775 - 44422724
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    |||||||||||||| |||||||||  | |||||||||||||| |||||||||    
44422775 agcttatgacatgtccataagctgactacagcttattttcataagctctcca 44422724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 255
Target Start/End: Original strand, 51695467 - 51695597
Alignment:
125 tttggaagaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacac 223  Q
    ||||||||||||||   | ||| ||||| |||| || |||||||| |||||||||||||||||| |  ||||||| |||| ||| ||||||| || | |     
51695467 tttggaagaacttatataaacaacttatcacattgttcataagctattttcagcttattttcataaattctccaagatagcttatgaaaacatctgataa 51695566  T
224 tttatacaaaaacaatttaacttcattttatc 255  Q
     |||||| |||||||||| |||| ||||||||    
51695567 cttatacgaaaacaattt-actttattttatc 51695597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 149 - 251
Target Start/End: Complemental strand, 4576878 - 4576776
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttca 248  Q
    |||||||||||  ||||| ||| |||||||||||||||| || | | ||| |||| ||| |||||||||||| |  || |||||||| | |||||||| |    
4576878 ttatgacatgtttataagttgtgttcagcttattttcataagttattcaatatagcttatgaaaacagcttataacttgtacaaaaatattttaacttta 4576779  T
249 ttt 251  Q
    |||    
4576778 ttt 4576776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 196
Target Start/End: Original strand, 4699597 - 4699659
Alignment:
134 acttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctcc 196  Q
    ||||| ||| ||| |||||||||||| ||||||||||||| |||||||||  || ||||||||    
4699597 acttatgaaaacaacttatgacatgttcataagctgtttttagcttatttctataagctctcc 4699659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #69
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 148 - 202
Target Start/End: Complemental strand, 6262094 - 6262040
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaata 202  Q
    |||||||||||| |||||||| |||||| ||||||| ||  ||||||||||||||    
6262094 cttatgacatgttcataagctattttcaacttatttccacaagctctccaaaata 6262040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #70
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 161 - 214
Target Start/End: Complemental strand, 10089767 - 10089716
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaac 214  Q
    |||||||||||||||||||||||||||   | ||||||||||||||| ||||||    
10089767 cataagctgttttcagcttattttcat--acactccaaaatagattatgaaaac 10089716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #71
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 24 - 74
Target Start/End: Original strand, 10850096 - 10850146
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttattt 74  Q
    |||||||||| ||||||| |||| ||||||| ||||||||||| |||||||    
10850096 cataaactacgttgacaaccttatgaataatacataaaagcttatttattt 10850146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #72
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 145 - 183
Target Start/End: Original strand, 12477280 - 12477318
Alignment:
145 cagcttatgacatgtgcataagctgttttcagcttattt 183  Q
    ||||||||||||||| |||||| ||||||||||||||||    
12477280 cagcttatgacatgtccataagttgttttcagcttattt 12477318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #73
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 131 - 216
Target Start/End: Original strand, 15942726 - 15942812
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagc-tgttttcagcttattttcatgagctctccaaaatagattaagaaaacag 216  Q
    |||| ||| ||| ||| |||||||||||| ||||||| ||||||||||||||||  || || ||||||| ||| |||| ||||||||    
15942726 agaatttatgaaaacaacttatgacatgttcataagcatgttttcagcttatttcaataagttctccaagataaattatgaaaacag 15942812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #74
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 24 - 74
Target Start/End: Original strand, 16888991 - 16889040
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttattt 74  Q
    ||||||||||||| ||||||||| ||||||| ||||||||||| |||||||    
16888991 cataaactacctt-acaagcttatgaataatacataaaagcttatttattt 16889040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #75
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 173 - 215
Target Start/End: Original strand, 21254768 - 21254810
Alignment:
173 tcagcttattttcatgagctctccaaaatagattaagaaaaca 215  Q
    ||||||||||||||| |||||||||| |||| |||||||||||    
21254768 tcagcttattttcataagctctccaagatagcttaagaaaaca 21254810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #76
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 146 - 184
Target Start/End: Original strand, 24460401 - 24460439
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttatttt 184  Q
    |||||||||||||| |||||||||||| |||||||||||    
24460401 agcttatgacatgttcataagctgtttccagcttatttt 24460439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #77
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 38001693 - 38001639
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagctt 179  Q
    ||||| |||||||| ||| |||||||||||| ||| |||||| ||||||||||||    
38001693 tttgggagaacttatgaaaacagcttatgacctgttcataagttgttttcagctt 38001639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #78
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 149 - 203
Target Start/End: Complemental strand, 47877182 - 47877128
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    ||||||||||  |||||| |||||||||||||||||||| |||| |||| |||||    
47877182 ttatgacatgctcataagttgttttcagcttattttcataagctttccataatag 47877128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 240
Target Start/End: Complemental strand, 2777983 - 2777874
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatac 230  Q
    |||||||| |||  || |||||||| | | ||||||| ||||||||||||||||||| || |||||||  ||  |||  ||||||||||| |  ||||||    
2777983 agaacttatgaaaccaacttatgacgtattcataagccgttttcagcttattttcataagttctccaagttaacttattaaaacagcttatagcttatac 2777884  T
231 aaaaacaatt 240  Q
    ||| ||||||    
2777883 aaagacaatt 2777874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 145 - 198
Target Start/End: Complemental strand, 4445785 - 4445732
Alignment:
145 cagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaa 198  Q
    |||||||| |||||| || |||||||||||| ||||||||||  ||||||||||    
4445785 cagcttataacatgttcagaagctgttttcaacttattttcacaagctctccaa 4445732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 4549945 - 4549888
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttatt 182  Q
    ||||| |||||||  ||| |||| ||||||||||| |||||| |||||||||||||||    
4549945 tttgggagaacttctgaaaacagattatgacatgttcataagttgttttcagcttatt 4549888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 213
Target Start/End: Complemental strand, 7941704 - 7941615
Alignment:
125 tttggaagaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaa 213  Q
    |||||||||| ||| ||| |||||||||||||| || |  ||||| |||||| ||||||||||| || ||||| |||||| ||| |||||    
7941704 tttggaagaatttatgaaaacagcttatgacattgttccgaagctattttcaacttattttcataagttctccgaaatagcttatgaaaa 7941615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 10082311 - 10082246
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgtttca 89  Q
    |||||||||||||||||| ||||  |||||  ||||||| ||| ||||||| |||||| |||||||    
10082311 cataaactaccttgacaaacttatcaataacacataaaaacttatttatttgcataagttgtttca 10082246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 10799535 - 10799486
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaa 198  Q
    |||||||||||  |||| ||||||||||||||||||||| || |||||||    
10799535 ttatgacatgtttataatctgttttcagcttattttcataagttctccaa 10799486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #85
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 215
Target Start/End: Original strand, 12564493 - 12564562
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaaca 215  Q
    ||||||||||| ||  ||||| |||||||||||||||| ||| || ||||||| |||| ||| |||||||    
12564493 agcttatgacaagtcaataagttgttttcagcttatttccataagttctccaagatagcttatgaaaaca 12564562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 147 - 220
Target Start/End: Original strand, 12593448 - 12593521
Alignment:
147 gcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||| ||||||||||||| ||||||||| ||  || ||| ||| |||||| |||| ||| ||||||||||||    
12593448 gcttataacatgtgcataagttgttttcaggtttattccataagcgctccaagatagcttatgaaaacagctta 12593521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 156 - 197
Target Start/End: Complemental strand, 15361106 - 15361065
Alignment:
156 atgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    |||| |||||| |||||||||||||||||||| |||||||||    
15361106 atgttcataagttgttttcagcttattttcataagctctcca 15361065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 149 - 198
Target Start/End: Complemental strand, 21002233 - 21002184
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaa 198  Q
    ||||||||||| |||||||||||||||  |||||||||| | ||||||||    
21002233 ttatgacatgtccataagctgttttcaatttattttcataacctctccaa 21002184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 146 - 251
Target Start/End: Complemental strand, 34405233 - 34405128
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaact 245  Q
    ||||||| |||||| |||||| | |||||||||| ||||||| ||| |||  | |||  ||| |||||  ||||| |  |||||||||||||||||||||    
34405233 agcttataacatgttcataagttattttcagctttttttcatcagcactctgagataatttatgaaaattgcttatagattatacaaaaacaatttaact 34405134  T
246 tcattt 251  Q
    | ||||    
34405133 ttattt 34405128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 164 - 253
Target Start/End: Complemental strand, 34952273 - 34952184
Alignment:
164 aagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcatttta 253  Q
    |||| ||||||||||||||||||| || ||||    |||| ||| ||||||| ||||||  |||| | ||||||||||||||| ||||||    
34952273 aagcagttttcagcttattttcataagttctctttgatagcttatgaaaacaacttacagcttattcgaaaacaatttaactttatttta 34952184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 131 - 203
Target Start/End: Original strand, 38503443 - 38503516
Alignment:
131 agaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    |||||||| | | ||||| |||||||| || |||||| |||||||||||||||||||| || ||||||| ||||    
38503443 agaacttatggaaacagcctatgacattgttcataagttgttttcagcttattttcataagttctccaagatag 38503516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 39270408 - 39270493
Alignment:
135 cttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||| ||| ||||||| || ||||| ||||||||||||||| |||||||||||  |||||| |   ||| ||| ||||||||||||    
39270408 cttatgaaaacagcttttggcatgtccataagctgttttcaacttattttcatatgctctctatggtagcttatgaaaacagctta 39270493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 125 - 194
Target Start/End: Original strand, 48748289 - 48748357
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctct 194  Q
    |||||||||||||| | |||||| |||| ||| || |||||| |||||||||||||||| ||| ||||||    
48748289 tttggaagaacttacggagacagtttat-acaagttcataagttgttttcagcttatttccataagctct 48748357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 192 - 255
Target Start/End: Original strand, 3069974 - 3070038
Alignment:
192 tctccaaaatagattaagaaaacagcttacactttatac-aaaaacaatttaacttcattttatc 255  Q
    ||||||| |||| ||| |||||||||||| |   ||||| |||||||||||||||||||||||||    
3069974 tctccaagatagcttacgaaaacagcttatagcatatacgaaaaacaatttaacttcattttatc 3070038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #95
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 180
Target Start/End: Original strand, 3070086 - 3070118
Alignment:
148 cttatgacatgtgcataagctgttttcagctta 180  Q
    |||||||||||| ||||||||||||||||||||    
3070086 cttatgacatgttcataagctgttttcagctta 3070118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #96
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 216
Target Start/End: Complemental strand, 4868474 - 4868406
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacag 216  Q
    ||||||||||||  ||||| |||||||| ||||||| ||| |||| | |||||||| ||| ||||||||    
4868474 cttatgacatgtcaataagttgttttcaacttatttacataagcttttcaaaatagtttacgaaaacag 4868406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #97
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 130 - 198
Target Start/End: Original strand, 7575677 - 7575744
Alignment:
130 aagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaa 198  Q
    ||||||||| ||| |  |||||||||| || |||||||||||| |||||||||||||| | ||||||||    
7575677 aagaacttatgaaaatggcttatgacaggttcataagctgttt-cagcttattttcataaactctccaa 7575744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #98
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 163 - 215
Target Start/End: Complemental strand, 11129304 - 11129252
Alignment:
163 taagctgttttcagcttattttcatgagctctccaaaatagattaagaaaaca 215  Q
    |||||||||||| | |||||| ||| ||||||||||||||| ||| |||||||    
11129304 taagctgttttcggtttatttccataagctctccaaaatagtttacgaaaaca 11129252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #99
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 24 - 121
Target Start/End: Complemental strand, 15791444 - 15791346
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatgggcc 121  Q
    ||||||||||||| | || ||||  |||||| ||||||| ||| ||||||||||||||||||||   ||||||||  || ||||| |||||||| |||||    
15791444 cataaactaccttaaaaa-cttataaataatacataaaaacttatttatttacataagctgttttatataagctctaaaataagttaatccaaacgggcc 15791346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #100
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 220
Target Start/End: Complemental strand, 16322923 - 16322851
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||| ||||  |||||| |||||| ||||||||| ||| |||||| ||||||||  || ||||||||||||    
16322923 cttatgtcatgcacataagttgtttttagcttatttccataagctcttcaaaatagcctatgaaaacagctta 16322851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #101
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 146 - 194
Target Start/End: Complemental strand, 20713732 - 20713684
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctct 194  Q
    |||||| ||||||| ||||||||||||| | ||||||||||| ||||||    
20713732 agcttacgacatgtccataagctgtttttatcttattttcataagctct 20713684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #102
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 244
Target Start/End: Complemental strand, 23445408 - 23445312
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaac 244  Q
    |||||||||||| |||||||| |||||| | | |||| |   ||||||||| |||| ||| ||||||| ||||    ||||||||||||||||||||    
23445408 cttatgacatgttcataagctattttcaacatgttttaagacgctctccaagatagcttatgaaaacaacttatggcttatacaaaaacaatttaac 23445312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #103
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 132 - 220
Target Start/End: Original strand, 23902047 - 23902135
Alignment:
132 gaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||| ||| | |||||||  |||||||||||| ||||||||||||| || ||| ||||||| || |||| ||  ||||||| ||||    
23902047 gaacttatgaaaagagcttatagcatgtgcataagttgttttcagcttacttccataagctctctaagatagcttttgaaaacaactta 23902135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #104
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 24 - 121
Target Start/End: Original strand, 26435200 - 26435298
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatgggcc 121  Q
    |||||||||| ||||||| ||||  |||||| ||||||| ||| ||||||| ||||||||||||   ||||||||| || || ||||||| ||| |||||    
26435200 cataaactactttgacaaacttaaaaataatacataaaa-cttatttatttgcataagctgttttgtataagctcaaaaatatgtcaatcaaaacgggcc 26435298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #105
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 156 - 216
Target Start/End: Original strand, 28077073 - 28077133
Alignment:
156 atgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacag 216  Q
    |||| |||||| ||||||||||||||||  || ||||||| ||||||| ||| ||||||||    
28077073 atgttcataagttgttttcagcttatttcaataagctctctaaaatagcttatgaaaacag 28077133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #106
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 151 - 255
Target Start/End: Complemental strand, 30371219 - 30371115
Alignment:
151 atgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcatt 250  Q
    ||||||||| |||||| ||||||||||||||||  ||  ||||||||||||   ||| ||||||| |||| |  |||||  |||||||||| | || |||    
30371219 atgacatgtccataagttgttttcagcttatttcaatacgctctccaaaatgtcttatgaaaacaacttatagcttatatgaaaacaatttgagtttatt 30371120  T
251 ttatc 255  Q
    |||||    
30371119 ttatc 30371115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #107
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 147 - 195
Target Start/End: Complemental strand, 33975645 - 33975597
Alignment:
147 gcttatgacatgtgcataagctgttttcagcttattttcatgagctctc 195  Q
    |||||||| |||| ||||| || |||||||||||||||||| |||||||    
33975645 gcttatgatatgtccataaactattttcagcttattttcataagctctc 33975597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 35350739 - 35350684
Alignment:
123 tatttggaagaactt-aggaagacagcttatgacatgtgcataagctgttttcagct 178  Q
    ||||||||||||||  ||||| ||| |||||||||||| ||||||||||||||||||    
35350739 tatttggaagaactcgaggaa-acaacttatgacatgtccataagctgttttcagct 35350684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 170 - 246
Target Start/End: Original strand, 38018382 - 38018458
Alignment:
170 ttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaactt 246  Q
    ||||||||||||||||||||  ||||||| |||   || |||||||||||  |  |||||| |||||||||||||||    
38018382 ttttcagcttattttcatgaattctccaagataatgtatgaaaacagcttctagcttatacgaaaacaatttaactt 38018458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #110
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 163 - 203
Target Start/End: Original strand, 39603842 - 39603882
Alignment:
163 taagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    |||||| |||||||||||||||||| |||| ||||||||||    
39603842 taagctattttcagcttattttcataagctatccaaaatag 39603882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #111
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 56 - 121
Target Start/End: Complemental strand, 41196682 - 41196615
Alignment:
56 cataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatgggcc 121  Q
    |||||| |||| ||||||| |||||||| |||  |||||||||| || |||| |||||||||||||||    
41196682 cataaaggcttatttatttgcataagctattttacataagctcaaaaataagccaatccaaatgggcc 41196615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #112
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 145 - 181
Target Start/End: Original strand, 45999281 - 45999317
Alignment:
145 cagcttatgacatgtgcataagctgttttcagcttat 181  Q
    ||||||||||||||| ||||| |||||||||||||||    
45999281 cagcttatgacatgttcataaactgttttcagcttat 45999317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 63; Significance: 4e-27; HSPs: 62)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 24 - 119
Target Start/End: Complemental strand, 32131501 - 32131404
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatggg 119  Q
    |||||||||||||||||| |||| ||||||||||||||||||| ||||||| ||||||||||||  |||||||||| || ||||||||||||||||||    
32131501 cataaactaccttgacaaacttaggaataatgcataaaagcttatttatttgcataagctgttttgcataagctcaaaaataagtcaatccaaatggg 32131404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 146 - 255
Target Start/End: Complemental strand, 12361268 - 12361159
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaact 245  Q
    |||||||||||||| ||||||||||||||| ||||||| ||| ||||||||  ||||  ||| |||||||||||| |  |||||  |||||||||| |||    
12361268 agcttatgacatgtccataagctgttttcaacttatttccattagctctcctgaataacttatgaaaacagcttatagcttatatgaaaacaatttgact 12361169  T
246 tcattttatc 255  Q
    ||||||||||    
12361168 tcattttatc 12361159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 146 - 251
Target Start/End: Original strand, 37353243 - 37353348
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaact 245  Q
    |||||||||||| | ||||| |||||||||| |||||||||| ||||||| || |||| |||||||||||||||| |   || |||||||||||||||||    
37353243 agcttatgacatattcataaactgttttcagattattttcataagctctcaaagatagcttaagaaaacagcttatagcatacacaaaaacaatttaact 37353342  T
246 tcattt 251  Q
    | ||||    
37353343 ttattt 37353348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 161 - 248
Target Start/End: Complemental strand, 27028892 - 27028805
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttca 248  Q
    |||||||| |||||||||||||||||| |||||||||| |||| ||| |||||||||||| |   |||||| ||||||||||||||||    
27028892 cataagctattttcagcttattttcataagctctccaagatagcttatgaaaacagcttatagcatatacacaaacaatttaacttca 27028805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 125 - 255
Target Start/End: Original strand, 42215279 - 42215409
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacact 224  Q
    ||||| |||||| | ||| |||||||||||| ||| ||||||||||||||||||||||| ||| |||||||||  ||||  || ||||| || ||| |      
42215279 tttgggagaactaatgaaaacagcttatgacttgttcataagctgttttcagcttatttacataagctctccaggatagcatatgaaaataggttataga 42215378  T
225 ttatacaaaaacaatttaacttcattttatc 255  Q
    ||||||||||||| ||| |||| ||||||||    
42215379 ttatacaaaaacagtttgactttattttatc 42215409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 27 - 83
Target Start/End: Original strand, 34286591 - 34286647
Alignment:
27 aaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    |||||||||||||||||||| ||||||| ||||||||||| ||||||||||||||||    
34286591 aaactaccttgacaagcttatgaataatacataaaagcttatttatttacataagct 34286647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 131 - 245
Target Start/End: Complemental strand, 10120848 - 10120733
Alignment:
131 agaacttaggaagacagcttatgacatgtg-cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttata 229  Q
    |||||||| ||| |||||||||||||| |  |||| |||||||||||||||||||||| || ||||||| |||| | | | |||||||||| |  |||||    
10120848 agaacttatgaaaacagcttatgacatttatcatatgctgttttcagcttattttcataagttctccaatatagttaatgtaaacagcttataggttata 10120749  T
230 caaaaacaatttaact 245  Q
    | ||||||||||||||    
10120748 ccaaaacaatttaact 10120733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 28879119 - 28879060
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| ||||||| ||||||||    
28879119 cataaactaccttgacaagcttatgaataatacataaaagcttatttatttgcataagct 28879060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 129 - 183
Target Start/End: Complemental strand, 3254318 - 3254264
Alignment:
129 gaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattt 183  Q
    |||||||||| ||| |||||||||||||||| |||||||||||||||||||||||    
3254318 gaagaacttaagaaaacagcttatgacatgttcataagctgttttcagcttattt 3254264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 147 - 197
Target Start/End: Complemental strand, 20672825 - 20672775
Alignment:
147 gcttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    ||||||||||||| ||||||||||||||||||||||||||| |||||||||    
20672825 gcttatgacatgttcataagctgttttcagcttattttcataagctctcca 20672775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 147 - 220
Target Start/End: Complemental strand, 11795167 - 11795094
Alignment:
147 gcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||||| ||||| ||||||||||||||||| ||| ||||||||| ||||| ||| |||| |||||||    
11795167 gcttatgacatgtccataacctgttttcagcttatttccataagctctccataatagcttatgaaatcagctta 11795094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 131 - 195
Target Start/End: Original strand, 2458545 - 2458609
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctc 195  Q
    |||||||| |||||||||||||| ||||| |||||||||||||||| |||||| ||| |||||||    
2458545 agaacttatgaagacagcttatggcatgttcataagctgttttcagtttatttccataagctctc 2458609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 11569449 - 11569525
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||||||||| |||||| |||||||||||||||||||  | |||||||  |||| ||| ||||||||||||    
11569449 acagcttatgacatgtacataagttgttttcagcttattttcaaaatctctccatgatagcttatgaaaacagctta 11569525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 123 - 214
Target Start/End: Complemental strand, 27754503 - 27754412
Alignment:
123 tatttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaac 214  Q
    ||||||| |||||||| ||| |||| ||||||||||   ||||| ||  |||||||||||||||| ||||||||||||||| ||| ||||||    
27754503 tatttgggagaacttatgaaaacagtttatgacatgattataagttgcgttcagcttattttcataagctctccaaaatagcttatgaaaac 27754412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 32975748 - 32975689
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| |||||||  |||||||||| ||||||| ||||||||    
32975748 cataaactaccttgacaagcttatgaataatatataaaagcttatttatttgcataagct 32975689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 123 - 220
Target Start/End: Complemental strand, 1930135 - 1930037
Alignment:
123 tatttggaagaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||| |||||||  ||| |||| ||||||||| || ||||||||||||||||||||||||||  || || |||| |||| ||| ||||||||||||    
1930135 tatttgggagaacttgtgaaaacagtttatgacattgttcataagctgttttcagcttattttcacaaggtcaccaagatagcttatgaaaacagctta 1930037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 28769337 - 28769407
Alignment:
150 tatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||| |||| |||||| |||||||||||||||| ||| | ||||||||||||| ||| ||||||||||||    
28769337 tatgatatgtccataagttgttttcagcttatttccataaactctccaaaatagcttatgaaaacagctta 28769407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 149 - 271
Target Start/End: Original strand, 28784793 - 28784914
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttca 248  Q
    ||||||||||| |||||||| ||||||||||||||| |  ||||||| || |||| ||| ||||| ||||||||  | |||  |||||||||| |||| |    
28784793 ttatgacatgttcataagct-ttttcagcttatttttacaagctctctaagatagcttatgaaaatagcttacaactgatatcaaaacaatttgacttta 28784891  T
249 ttttatcacttatattagaaata 271  Q
    |||||||  |||| |||||||||    
28784892 ttttatcttttattttagaaata 28784914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 131 - 194
Target Start/End: Complemental strand, 13459736 - 13459673
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctct 194  Q
    |||||||| ||| |||||||||||||| | ||||| ||||||||||| ||||||||| ||||||    
13459736 agaacttatgaaaacagcttatgacattttcataaactgttttcagcctattttcataagctct 13459673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 164 - 251
Target Start/End: Complemental strand, 18133714 - 18133627
Alignment:
164 aagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattt 251  Q
    ||||| |||||||||||||||||| || ||||||| |||| |||  ||| ||||||| |   ||||||||| ||||||||||||||||    
18133714 aagcttttttcagcttattttcataagttctccaatatagtttataaaaccagcttataggatatacaaaagcaatttaacttcattt 18133627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 148 - 203
Target Start/End: Complemental strand, 21653155 - 21653100
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    ||||||||| || |||||||| |||||||||||||||||| |||||||||| ||||    
21653155 cttatgacacgttcataagctattttcagcttattttcataagctctccaagatag 21653100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 148 - 195
Target Start/End: Complemental strand, 31862567 - 31862520
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctc 195  Q
    |||||||| | ||||||||||||||||||||||||||||| |||||||    
31862567 cttatgacctatgcataagctgttttcagcttattttcataagctctc 31862520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 32213047 - 32213106
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||| | ||||||||||| ||||||| ||||||||||| ||||||| ||||||||    
32213047 cataaactaacctgacaagcttatgaataatacataaaagcttatttatttgcataagct 32213106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 35453471 - 35453412
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||| || |||| ||||||| ||||||||||| ||||||| ||||||||    
35453471 cataaactaccttgataaacttatgaataatacataaaagcttatttatttgcataagct 35453412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 132 - 255
Target Start/End: Complemental strand, 38537681 - 38537558
Alignment:
132 gaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttataca 231  Q
    ||||||| ||| ||| |||| ||||||  |||||||| ||||| |||||||| |||||| | | ||  |||| ||| |||| ||||||| |  |||||||    
38537681 gaacttatgaaaacaacttacgacatgctcataagctattttcggcttatttccatgagtttttcaggatagtttatgaaagcagcttatagattataca 38537582  T
232 aaaacaatttaacttcattttatc 255  Q
    ||||||| || |||||||||||||    
38537581 aaaacaaattgacttcattttatc 38537558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 149 - 195
Target Start/End: Complemental strand, 9700074 - 9700028
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctc 195  Q
    ||||||||||| ||||||||||||||| ||||||||||| |||||||    
9700074 ttatgacatgtccataagctgttttcaccttattttcataagctctc 9700028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 161 - 255
Target Start/End: Complemental strand, 10114550 - 10114457
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattttatc 255  Q
    |||| ||||||||||||||||||||||  | ||||||| |||| | | |||||||||||| |  |||||| ||||||||| ||||| ||||||||    
10114550 catatgctgttttcagcttattttcatatgttctccaatatagctaatgaaaacagcttatagcttataccaaaacaattcaactt-attttatc 10114457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 132 - 194
Target Start/End: Complemental strand, 10383975 - 10383913
Alignment:
132 gaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctct 194  Q
    ||||||| ||| |||||||||||||| | |||||||||||| |||||||||| ||| ||||||    
10383975 gaacttatgaaaacagcttatgacattttcataagctgtttacagcttatttccataagctct 10383913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 133 - 195
Target Start/End: Complemental strand, 12851265 - 12851203
Alignment:
133 aacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctc 195  Q
    |||||| ||| ||||||||| |||||| |||||| ||||||| |||||||||||| |||||||    
12851265 aacttatgaaaacagcttataacatgttcataagatgttttcggcttattttcataagctctc 12851203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 220
Target Start/End: Complemental strand, 34290949 - 34290871
Alignment:
142 agacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||| |||||| |||||||  |||||||||||||||||| | |||||||  ||||||||  |||||| ||||    
34290949 agacagcttattacatgtccataagcctttttcagcttattttcattaactctccaggatagattagaaaaacaactta 34290871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 24 - 66
Target Start/End: Original strand, 35168466 - 35168508
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagctt 66  Q
    ||||||||||||||||||||||| ||||||| |||||||||||    
35168466 cataaactaccttgacaagcttatgaataatacataaaagctt 35168508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 146 - 255
Target Start/End: Complemental strand, 30389175 - 30389066
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaact 245  Q
    |||| ||||||||| |||||| |||||||||||||||||||| || |||| |  | || ||| ||||||||| || |  ||||| |||| |||| ||| |    
30389175 agctaatgacatgttcataagttgttttcagcttattttcataagttctctaggaaagcttatgaaaacagcgtatagcttatataaaagcaatctaatt 30389076  T
246 tcattttatc 255  Q
    ||||||||||    
30389075 tcattttatc 30389066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 148 - 220
Target Start/End: Complemental strand, 7714316 - 7714244
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||| ||||  || ||||||||||| |||||||||||||||||||||| |||| | | ||||||| ||||    
7714316 cttatgaaatgtcgatgagctgttttcaacttattttcatgagctctccaagatagctcatgaaaacaactta 7714244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 13265541 - 13265489
Alignment:
28 aactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataa 80  Q
    |||||| |||||||||||| ||||||| ||||||||||| ||||||| |||||    
13265541 aactactttgacaagcttatgaataatacataaaagcttatttatttgcataa 13265489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 140 - 184
Target Start/End: Original strand, 31885049 - 31885093
Alignment:
140 gaagacagcttatgacatgtgcataagctgttttcagcttatttt 184  Q
    |||||||||||||||||| | |||||||| |||||||||||||||    
31885049 gaagacagcttatgacatattcataagctattttcagcttatttt 31885093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 152 - 220
Target Start/End: Original strand, 33714236 - 33714304
Alignment:
152 tgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||| ||| |||||||||||||||||||||||| || |||||||| | |||| ||| ||||| ||||||    
33714236 tgacttgttcataagctgttttcagcttatttttataagctctcccagatagcttatgaaaatagctta 33714304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 124 - 220
Target Start/End: Original strand, 44426380 - 44426476
Alignment:
124 atttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||||||||  || |||||||| ||| ||| |||||| |  ||| ||||||||||| | |||| |||| ||||| ||| ||||||||||||    
44426380 atttggaagaacttataaaaacagcttacgacgtgttcataagttcctttaagcttattttcgtaagctgtccacaatagcttatgaaaacagctta 44426476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 184
Target Start/End: Original strand, 779034 - 779093
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttatttt 184  Q
    |||| ||||||||| ||| ||| |||||||||||| |||||| |||||||| ||||||||    
779034 tttgaaagaacttacgaaaacaacttatgacatgttcataagttgttttcatcttatttt 779093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 144 - 255
Target Start/End: Original strand, 6509295 - 6509406
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaa 243  Q
    |||||||||||||||   |||| || |||||| |||||||  || |||||||||  |||| ||| |||||||||||| |  ||||| ||| ||||||| |    
6509295 acagcttatgacatgcctataaactattttcaccttatttcaataagctctccaggatagcttatgaaaacagcttatagcttatataaatacaatttga 6509394  T
244 cttcattttatc 255  Q
    ||| ||||||||    
6509395 ctttattttatc 6509406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 144 - 183
Target Start/End: Original strand, 9835892 - 9835931
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattt 183  Q
    |||||||||||||||| ||||||||||||||| |||||||    
9835892 acagcttatgacatgttcataagctgttttcatcttattt 9835931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 169 - 220
Target Start/End: Original strand, 9956831 - 9956882
Alignment:
169 gttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||||||||||| || ||||||| |||||||| ||||||| ||||    
9956831 gttttcagcttattttcataagttctccaagatagattatgaaaacaactta 9956882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 148 - 183
Target Start/End: Complemental strand, 14949940 - 14949905
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattt 183  Q
    |||||||||||| |||||||||||||||||||||||    
14949940 cttatgacatgtccataagctgttttcagcttattt 14949905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 192 - 255
Target Start/End: Complemental strand, 29205838 - 29205775
Alignment:
192 tctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattttatc 255  Q
    |||||||||||| ||| ||||| | |||| |   ||||||||||||||||||||||||||||||    
29205838 tctccaaaatagtttatgaaaataacttatagcatatacaaaaacaatttaacttcattttatc 29205775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 125 - 187
Target Start/End: Original strand, 32840958 - 32841021
Alignment:
125 tttggaagaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcat 187  Q
    ||||| |||||||| ||| ||| |||||||||| || |||||| ||||||||||||||||||||    
32840958 tttgggagaacttatgaaaacaacttatgacattgttcataagttgttttcagcttattttcat 32841021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 24 - 87
Target Start/End: Complemental strand, 35285989 - 35285926
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt 87  Q
    |||||||||| ||||| |||||| ||||||  || |||||||| ||||||| ||||||||||||    
35285989 cataaactactttgacgagcttatgaataacacacaaaagcttatttatttgcataagctgttt 35285926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 161 - 220
Target Start/End: Complemental strand, 38874707 - 38874648
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||| |||| |||||||||||||  | |||||||||||| ||| ||||||||||||    
38874707 cataagctatttttagcttattttcatatgttctccaaaatagcttatgaaaacagctta 38874648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 144 - 195
Target Start/End: Original strand, 41606895 - 41606946
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctc 195  Q
    |||||||||||||||| || ||| |||||||||||||||| ||| |||||||    
41606895 acagcttatgacatgttcaaaagttgttttcagcttatttccataagctctc 41606946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 154 - 213
Target Start/End: Original strand, 42215084 - 42215143
Alignment:
154 acatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaa 213  Q
    |||||| |||||| |||||||||||||||| ||| |||||||||| |||| ||| |||||    
42215084 acatgttcataagttgttttcagcttatttacataagctctccaagatagcttatgaaaa 42215143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 125 - 215
Target Start/End: Original strand, 7918419 - 7918509
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaaca 215  Q
    ||||| ||| |||| ||| ||| |||| ||||||| |||||||||||| || |||||||  || |||||||||| |||| ||| |||||||    
7918419 tttgggagagcttatgaaaacaacttaagacatgttcataagctgtttccaacttatttcaataagctctccaagatagcttacgaaaaca 7918509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 146 - 220
Target Start/End: Complemental strand, 31705161 - 31705087
Alignment:
146 agcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||| || |||||||||||||||||||||||||||| ||| | ||||| |  | || ||| ||||||||||||    
31705161 agcttaagagatgtgcataagctgttttcagcttatttccataaactctcaaggacagcttatgaaaacagctta 31705087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 149 - 255
Target Start/End: Complemental strand, 34849176 - 34849070
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttca 248  Q
    ||||||||||| ||||||| |||||||||| |||| ||| || ||| ||| | || ||| || ||||||||| |  ||||||||||| ||| | |||| |    
34849176 ttatgacatgttcataagccgttttcagctgatttccataagttctacaagaaagcttatgataacagcttatatcttatacaaaaataatgtgacttta 34849077  T
249 ttttatc 255  Q
    |||||||    
34849076 ttttatc 34849070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 167 - 254
Target Start/End: Original strand, 36338277 - 36338366
Alignment:
167 ctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttataca--aaaacaatttaacttcattttat 254  Q
    ||||||||||||||||||||| || |||| || |||  |||  ||||||||||| |  |||||||  ||||||||| |||||||||||||    
36338277 ctgttttcagcttattttcataagttctcaaagatattttataaaaacagcttatatcttatacaagaaaacaattcaacttcattttat 36338366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 170 - 216
Target Start/End: Original strand, 44236841 - 44236887
Alignment:
170 ttttcagcttattttcatgagctctccaaaatagattaagaaaacag 216  Q
    |||||||||||||||||| |||||||||| |||| ||| ||||||||    
44236841 ttttcagcttattttcataagctctccaatatagcttatgaaaacag 44236887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 161 - 234
Target Start/End: Complemental strand, 8062390 - 8062317
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaa 234  Q
    |||||| |||||||||||||||| ||| | ||||| || |||| ||| |||||||||||| |  ||||||||||    
8062390 cataagatgttttcagcttatttccataatctctctaagatagcttatgaaaacagcttatagcttatacaaaa 8062317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 11183619 - 11183570
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    ||||||| ||||  |||||||||||||||||||||| ||| |||||||||    
11183619 cttatgatatgtctataagctgttttcagcttatttccataagctctcca 11183570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 25869262 - 25869311
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    |||||||||||| |||||| |||||||||||||||| ||| | |||||||    
25869262 cttatgacatgtccataagttgttttcagcttatttccataaactctcca 25869311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 184
Target Start/End: Original strand, 11118993 - 11119029
Alignment:
148 cttatgacatgtgcataagctgttttcagcttatttt 184  Q
    |||||||||||| ||||||||||||||||| ||||||    
11118993 cttatgacatgttcataagctgttttcagcatatttt 11119029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 161 - 213
Target Start/End: Complemental strand, 11494207 - 11494155
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaa 213  Q
    ||||||||| ||||||||||||||||| |||||| ||| |||| ||| |||||    
11494207 cataagctgctttcagcttattttcataagctcttcaagatagcttatgaaaa 11494155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 56 - 121
Target Start/End: Original strand, 28879169 - 28879236
Alignment:
56 cataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatgggcc 121  Q
    ||||||||||| ||||||| |||||||| |||  |||||||| | || |||||||||||||| |||||    
28879169 cataaaagcttatttatttgcataagctatttttcataagctaaaaaataagtcaatccaaacgggcc 28879236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 144 - 187
Target Start/End: Original strand, 31751548 - 31751592
Alignment:
144 acagcttatgacat-gtgcataagctgttttcagcttattttcat 187  Q
    |||||||||||||| || |||||||| ||||||||||||||||||    
31751548 acagcttatgacattgttcataagctattttcagcttattttcat 31751592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 148 - 220
Target Start/End: Original strand, 31875591 - 31875663
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||||| |||||||  |||||| ||||||||||| ||||||  || |||| ||||  ||||||||||    
31875591 cttatgacatgtccataagccattttcaacttattttcataagctcttgaagatagtttaaagaaacagctta 31875663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 155 - 203
Target Start/End: Original strand, 39866737 - 39866785
Alignment:
155 catgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    ||||| |||||||||||||||| |||||||||| |||||| ||| ||||    
39866737 catgtccataagctgttttcagtttattttcataagctcttcaagatag 39866785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 61; Significance: 6e-26; HSPs: 91)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 125 - 252
Target Start/End: Complemental strand, 21367765 - 21367637
Alignment:
125 tttggaagaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacac 223  Q
    ||||| |||||||| ||| |||||||||||||| || || |||||||||||||||||||||||| || ||||||| |||| ||| ||||||| |||| ||    
21367765 tttgggagaacttatgaaaacagcttatgacattgttcacaagctgttttcagcttattttcataagttctccaagatagcttatgaaaacaacttatac 21367666  T
224 tttatacaaaaacaatttaacttcatttt 252  Q
     |||||| ||||||||||||||| |||||    
21367665 attatacgaaaacaatttaactttatttt 21367637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 125 - 249
Target Start/End: Original strand, 54837007 - 54837131
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacact 224  Q
    |||||||||| ||| ||| |||||||||||||||| |||||  ||||||| ||||||||| || |||| ||||| |||| ||| ||||| | |||||| |    
54837007 tttggaagaatttatgaaaacagcttatgacatgttcataacttgttttccgcttatttttataagctgtccaagatagcttatgaaaataacttacagt 54837106  T
225 ttatacaaaaacaatttaacttcat 249  Q
    ||||||||||||||| || ||||||    
54837107 ttatacaaaaacaatgtatcttcat 54837131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 39602181 - 39602278
Alignment:
123 tatttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||| |||| |||||||||||||||||||| |||||  |||||||| ||||||||||| || |||| || |||| ||| ||||||||||||    
39602181 tatttggaagagcttatgaagacagcttatgacatgttcataaattgttttcaacttattttcataagttctcaaagatagcttatgaaaacagctta 39602278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 125 - 255
Target Start/End: Complemental strand, 30443991 - 30443860
Alignment:
125 tttggaagaacttaggaagacagcttatgaca-tgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacac 223  Q
    ||||| ||| |||| ||| ||||||||||||| | | || ||||| |||||||||||||||||| || ||||||| |||| |||  ||||||||||| |     
30443991 tttggtagagcttatgaaaacagcttatgacaattttcacaagcttttttcagcttattttcataagttctccaatatagtttataaaaacagcttatag 30443892  T
224 tttatacaaaaacaatttaacttcattttatc 255  Q
      ||||||||| ||||||||||||||||||||    
30443891 catatacaaaagcaatttaacttcattttatc 30443860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 24 - 115
Target Start/End: Original strand, 34707738 - 34707831
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaa 115  Q
    ||||||||||||| ||||||||| ||||||| ||||||||||| | ||||||| |||| |||||  |||||||||| || ||||||||||||||    
34707738 cataaactaccttaacaagcttatgaataatacataaaagcttatatatttacgtaagttgttttgcataagctcaaaaataagtcaatccaaa 34707831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 123 - 252
Target Start/End: Original strand, 1217771 - 1217900
Alignment:
123 tatttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttaca 222  Q
    ||||||||||| |||| | | |||||||||||||||| |||||| |||||||| |||| |||||| || |||| |  |||| ||| |||||||||||| |    
1217771 tatttggaagagcttacggaaacagcttatgacatgtccataagttgttttcatcttactttcataagttctcaaggatagcttatgaaaacagcttata 1217870  T
223 ctttatacaaaaacaatttaacttcatttt 252  Q
      ||| |  |||||||||||||||||||||    
1217871 acttacatgaaaacaatttaacttcatttt 1217900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 24 - 118
Target Start/End: Original strand, 40581102 - 40581198
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaatgg 118  Q
    |||||||||||||||||||||||  |||||| ||||||||||| ||||||| |||||| |||||  |||||||||| |  |||||||||| ||||||    
40581102 cataaactaccttgacaagcttattaataatacataaaagcttatttatttgcataagttgttttgcataagctcaaagataagtcaatcaaaatgg 40581198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 131 - 255
Target Start/End: Original strand, 30573893 - 30574017
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatac 230  Q
    |||||||| ||| |||  ||||| ||||| ||||||||||||||||||||| ||||| |||||||||| |||| ||| ||||||| | || |  |||||     
30573893 agaacttatgaaaacaaattatggcatgttcataagctgttttcagcttatgttcatcagctctccaagatagcttatgaaaacatcatatagattataa 30573992  T
231 aaaaacaatttaacttcattttatc 255  Q
    ||||| || ||||||| ||||||||    
30573993 aaaaaaaacttaactttattttatc 30574017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 125 - 243
Target Start/End: Original strand, 402514 - 402633
Alignment:
125 tttggaagaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacac 223  Q
    ||||| ||||| || ||| |||||||||||||| || |||||||||||||||||||| |||||  || ||| ||| ||||||||  ||||||||||| |     
402514 tttgggagaacgtatgaaaacagcttatgacattgttcataagctgttttcagcttaatttcacaagttcttcaagatagattataaaaacagcttataa 402613  T
224 tttatacaaaaacaatttaa 243  Q
     |||||| ||||||||||||    
402614 cttatacgaaaacaatttaa 402633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 148 - 255
Target Start/End: Complemental strand, 1816657 - 1816550
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttc 247  Q
    |||||||||| | |||| ||||||||||||||||||| || |||||||||  |||| ||| ||||||| |||| |  ||||||||||||| ||| ||||     
1816657 cttatgacattttcataggctgttttcagcttattttgataagctctccagtatagcttatgaaaacaacttatatcttatacaaaaacagtttgacttt 1816558  T
248 attttatc 255  Q
    ||||||||    
1816557 attttatc 1816550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 20669244 - 20669174
Alignment:
150 tatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||| |||||||||||||| |||||||| ||| |||||||||| |||| ||| ||||||||||||    
20669244 tatgacatgttcataagctgttttccgcttatttacataagctctccaagatagcttatgaaaacagctta 20669174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 149 - 271
Target Start/End: Complemental strand, 52619076 - 52618954
Alignment:
149 ttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttca 248  Q
    ||||||||||| |||||||| |||||| ||||||||||  |||||| ||| |||| ||  |||||||||||| |  |||||  ||||||||||||||| |    
52619076 ttatgacatgttcataagctattttcaccttattttcacaagctcttcaagatagcttgtgaaaacagcttataacttatatgaaaacaatttaacttta 52618977  T
249 ttttatcacttatattagaaata 271  Q
    ||| |||| || | |||||||||    
52618976 tttaatcatttgttttagaaata 52618954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 24 - 115
Target Start/End: Original strand, 53218065 - 53218158
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaa 115  Q
    ||||||||||||||||||||||| ||||||| ||||||| ||| ||||||  |||||| |||||  |||||||| | || ||||||||||||||    
53218065 cataaactaccttgacaagcttatgaataatacataaaatcttatttattcgcataagttgttttgcataagctaaaaaataagtcaatccaaa 53218158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 123 - 255
Target Start/End: Original strand, 34610776 - 34610909
Alignment:
123 tatttggaagaacttaggaagacagcttatgacat-gtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttac 221  Q
    ||||||| |||||||| ||| || ||||||||||| || ||||||  |||||||||| |||||||| || || |||| |||| ||| |||| || ||||     
34610776 tatttgggagaacttatgaaaactgcttatgacattgttcataagtggttttcagctgattttcataagttcgccaagatagcttatgaaagcaacttat 34610875  T
222 actttatacaaaaacaatttaacttcattttatc 255  Q
    |  || |||||||| |||||||||||||||||||    
34610876 aacttgtacaaaaataatttaacttcattttatc 34610909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 129 - 213
Target Start/End: Complemental strand, 45541664 - 45541580
Alignment:
129 gaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaa 213  Q
    |||||||||| ||| |||||||||||||||| |||||||||||||||| ||||| |||| || | ||||| |||| ||| |||||    
45541664 gaagaacttatgaaaacagcttatgacatgttcataagctgttttcaggttattctcataagttatccaagatagcttatgaaaa 45541580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 115
Target Start/End: Original strand, 22809218 - 22809312
Alignment:
24 cataaactaccttgacaagcttacgaataatgcat-aaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaa 115  Q
    ||||||||||||||||||||||| |||||||  || |||||||| ||||||| ||||||||||||  ||||| |||| || ||||||||| ||||    
22809218 cataaactaccttgacaagcttatgaataatatataaaaagcttatttatttgcataagctgttttgcataacctcaaaaataagtcaattcaaa 22809312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 144 - 203
Target Start/End: Complemental strand, 36139956 - 36139897
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    |||||||||||||||| || |||||||||||||||||||||||| |||||| ||| ||||    
36139956 acagcttatgacatgttcacaagctgttttcagcttattttcataagctcttcaagatag 36139897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 43079959 - 43080018
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| ||||||  ||||||||||| ||||||| ||||||||    
43079959 cataaactaccttgacaagcttatgaataacacataaaagcttatttatttgcataagct 43080018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 125 - 220
Target Start/End: Original strand, 50600151 - 50600246
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    ||||||||||||||  || ||| || ||||||||| ||  ||||||||||||||||||||||| || ||||||| |||| | | ||||||||||||    
50600151 tttggaagaacttataaaaacaactcatgacatgtccacgagctgttttcagcttattttcataagttctccaatatagctgatgaaaacagctta 50600246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 52421166 - 52421225
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| ||||||| | ||||||    
52421166 cataaactaccttgacaagcttatgaataatacataaaagcttatttatttgcgtaagct 52421225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 133 - 187
Target Start/End: Complemental strand, 5391968 - 5391914
Alignment:
133 aacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcat 187  Q
    |||||| ||| |||||||||||||||| ||||||||||||||| |||||||||||    
5391968 aacttatgaaaacagcttatgacatgttcataagctgttttcaacttattttcat 5391914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 161 - 255
Target Start/End: Original strand, 32095200 - 32095294
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattttatc 255  Q
    ||||||||  ||| |||||||||| || || | | ||| |||||||| |||||| ||||| | ||||||||||||||||||||||| ||||||||    
32095200 cataagctaattttagcttatttttattagtttttcaagatagattatgaaaacggcttatagtttatacaaaaacaatttaacttaattttatc 32095294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 123 - 197
Target Start/End: Complemental strand, 34954180 - 34954107
Alignment:
123 tatttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    |||||||||||||||  ||| |||||| ||||||||| ||| ||||||||||||||||||||||| |||| ||||    
34954180 tatttggaagaacttgtgaaaacagct-atgacatgttcatgagctgttttcagcttattttcataagctatcca 34954107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 144 - 194
Target Start/End: Complemental strand, 36101646 - 36101596
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctct 194  Q
    |||||||||||||||| || |||||||||||||||||||||||| ||||||    
36101646 acagcttatgacatgttcacaagctgttttcagcttattttcataagctct 36101596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 151 - 241
Target Start/End: Complemental strand, 40665500 - 40665410
Alignment:
151 atgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaattt 241  Q
    ||||||||| |||||||||||||||||||||||| || |||||||||| |||  ||| ||||||| |||| |  ||| ||||||| |||||    
40665500 atgacatgttcataagctgttttcagcttatttttataagctctccaagataacttatgaaaacatcttataacttacacaaaaataattt 40665410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 148 - 197
Target Start/End: Original strand, 3044255 - 3044304
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    |||||||||||| ||||||||||||||| ||||||||||| |||||||||    
3044255 cttatgacatgttcataagctgttttcaacttattttcataagctctcca 3044304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 125 - 182
Target Start/End: Complemental strand, 24624307 - 24624250
Alignment:
125 tttggaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttatt 182  Q
    ||||||||| |||| ||| |||||||||||||||| ||||| ||||||||||||||||    
24624307 tttggaagagcttatgaaaacagcttatgacatgtccataaactgttttcagcttatt 24624250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 148 - 197
Target Start/End: Complemental strand, 25925816 - 25925767
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctcca 197  Q
    |||||||||||| ||||||||||||||| ||||||||||| |||||||||    
25925816 cttatgacatgttcataagctgttttcaacttattttcataagctctcca 25925767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 129 - 194
Target Start/End: Original strand, 27290878 - 27290943
Alignment:
129 gaagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctct 194  Q
    ||||| |||| ||| |||||||||||||||  ||||||||||||||||||||||| ||||| ||||    
27290878 gaagagcttatgaaaacagcttatgacatgcccataagctgttttcagcttatttccatgaactct 27290943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 161 - 246
Target Start/End: Original strand, 28622008 - 28622093
Alignment:
161 cataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaactt 246  Q
    |||||||||||||||| |||||||||| || |||| || |||| ||| |||||||||||| |  ||| |||||||||| |||||||    
28622008 cataagctgttttcaggttattttcataagttctcgaagatagtttatgaaaacagcttatagcttacacaaaaacaacttaactt 28622093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 130 - 187
Target Start/End: Original strand, 39723218 - 39723275
Alignment:
130 aagaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcat 187  Q
    |||||||||  || |||||||||||||||| |||||||||||||||||||||| ||||    
39723218 aagaacttatcaaaacagcttatgacatgttcataagctgttttcagcttattctcat 39723275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 41633431 - 41633362
Alignment:
151 atgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctta 220  Q
    |||||||||  ||||  |||||||||||||||||||| ||||||||||||||| | | ||||||||||||    
41633431 atgacatgtctataaattgttttcagcttattttcataagctctccaaaatagctgatgaaaacagctta 41633362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 123 - 246
Target Start/End: Complemental strand, 20880576 - 20880452
Alignment:
123 tatttggaagaacttaggaagacagcttatgaca-tgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttac 221  Q
    ||||||| ||||| || ||| ||||||||||||| | | |||||||| |||| ||||||||||||| || ||||||| |||| ||   ||||||| |||     
20880576 tatttgggagaacctatgaaaacagcttatgacaattttcataagcttttttgagcttattttcataagttctccaatatagcttttaaaaacagtttat 20880477  T
222 actttatacaaaaacaatttaactt 246  Q
    |   |||||||||||||||||||||    
20880476 agcatatacaaaaacaatttaactt 20880452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 131 - 203
Target Start/End: Complemental strand, 50952424 - 50952352
Alignment:
131 agaacttaggaagacagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatag 203  Q
    ||||| || ||| |||||||||||||||| ||||| ||||||| ||||||||| ||| |||||||||| ||||    
50952424 agaacgtacgaaaacagcttatgacatgttcataaactgttttaagcttatttccataagctctccaagatag 50952352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 144 - 216
Target Start/End: Original strand, 54180772 - 54180844
Alignment:
144 acagcttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacag 216  Q
    |||||||||||||||| |||||| |||||| |||||||||  || ||||||||| ||||| ||| ||||||||    
54180772 acagcttatgacatgtccataagttgtttttagcttatttatataagctctccataatagcttatgaaaacag 54180844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 148 - 219
Target Start/End: Complemental strand, 31010476 - 31010405
Alignment:
148 cttatgacatgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagctt 219  Q
    |||||||||||| |||||||||||||||||||| || ||| ||||||| |  |||| ||| |||||||||||    
31010476 cttatgacatgtccataagctgttttcagcttaattccataagctctctatgataggttacgaaaacagctt 31010405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 156 - 255
Target Start/End: Original strand, 36783338 - 36783437
Alignment:
156 atgtgcataagctgttttcagcttattttcatgagctctccaaaatagattaagaaaacagcttacactttatacaaaaacaatttaacttcattttatc 255  Q
    |||| ||||||||||||||||||||| ||||| |   |||||| |||| ||| |||||||||| | | ||||||  |||||||||| |||| ||||||||    
36783338 atgttcataagctgttttcagcttatattcataattgctccaatatagcttatgaaaacagctaatagtttatatgaaaacaattttactttattttatc 36783437  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 83
Target Start/End: Original strand, 40240602 - 40240661
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    |||||||||||| |||| ||||| ||||||| ||||||||||| ||||||| ||||||||    
40240602 cataaactacctagacacgcttatgaataatacataaaagcttctttatttgcataagct 40240661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 52021307 - 52021248
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagct 83  Q
    |||||||||||||||||| |||| ||||||| ||||||||| | ||||||| ||||||||    
52021307 cataaactaccttgacaatcttatgaataatacataaaagcatatttatttgcataagct 52021248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 24 - 115
Target Start/End: Complemental strand, 585081 - 584988
Alignment:
24 cataaactaccttgacaagcttacgaataatgcataaaagcttgtttatttacataagctgttt--cataagctcagaagtaagtcaatccaaa 115  Q
    ||||||||||||  | ||||||  ||||||||||||||||||| ||||||| |||||  |||||  |||||||| | || ||||||||||||||    
585081 cataaactacctcaagaagcttttgaataatgcataaaagcttatttatttgcataatgtgttttacataagctgaaaaataagtcaatccaaa 584988  T

Back To: [ HSP Overview ] [