View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-15 (Length: 771)

Name: F9164J-LTR4-TNT-insertion-15
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-15
F9164J-LTR4-TNT-insertion-15
[»] chr5 (21 HSPs)
chr5 (8-762)||(8639771-8640525)
chr5 (544-659)||(8635656-8635771)
chr5 (478-605)||(8676973-8677100)
chr5 (478-605)||(8642955-8643082)
chr5 (18-83)||(9002283-9002348)
chr5 (18-84)||(8527858-8527924)
chr5 (23-84)||(9075335-9075396)
chr5 (216-306)||(8643322-8643416)
chr5 (18-84)||(8643507-8643573)
chr5 (18-83)||(8636090-8636155)
chr5 (211-306)||(8635895-8635998)
chr5 (514-575)||(8533941-8533998)
chr5 (18-78)||(8534438-8534500)
chr5 (516-558)||(8549470-8549512)
chr5 (20-84)||(8420415-8420479)
chr5 (29-77)||(8534703-8534751)
chr5 (18-84)||(8549077-8549144)
chr5 (29-72)||(8640688-8640731)
chr5 (551-589)||(9075780-9075818)
chr5 (29-66)||(1601079-1601116)
chr5 (542-575)||(8527359-8527392)
[»] chr4 (2 HSPs)
chr4 (18-84)||(9442025-9442091)
chr4 (542-575)||(9441693-9441726)
[»] chr1 (3 HSPs)
chr1 (26-79)||(26324948-26325001)
chr1 (18-77)||(5129794-5129853)
chr1 (29-72)||(5130076-5130119)
[»] chr7 (1 HSPs)
chr7 (29-84)||(48362774-48362829)
[»] scaffold0627 (1 HSPs)
scaffold0627 (30-67)||(3774-3811)


Alignment Details
Target: chr5 (Bit Score: 709; Significance: 0; HSPs: 21)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 709; E-Value: 0
Query Start/End: Original strand, 8 - 762
Target Start/End: Complemental strand, 8640525 - 8639771
Alignment:
8 gtttcgtaccattggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgatnnnnnnnctgaaatcttgaatga 107  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||    
8640525 gtttcgtaccattggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgataaaaaaactgaaatcttgaatga 8640426  T
108 tcaaaatttgaatgatgacagttatcatcctcctttagtgaccagacttttgataaagagcacaactacaaaaaggaatttcataaaacattttaggata 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8640425 tcaaaatttgaatgatgacagttatcatcctcctttagtgaccagacttttgataaagagcacaactacaaaaaggaatttcataaaacattttaggata 8640326  T
208 aagggttaatgctaaatcagaattatgatatttcaaaaaatgcatatctcattttaggatgcaaacaatgtctttttgtaagctttaattcagatgttcc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8640325 aagggttaatgctaaatcagaattatgatatttcaaaaaatgcatatctcattttaggatgcaaacaatgtctttttgtaagctttaattcagatgttcc 8640226  T
308 ttagtcatgtcattatctatggttcctaattgcctatatgtccttttcttcatctatcccatttgcatagattgtcttggtctctaactgctccttgaaa 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
8640225 ttagtcatgtcattatctatggttcctaattgcctatatgtccttttcttcatctatcccatttgcatagattgtcttggtctttaactgctccttgaaa 8640126  T
408 aaggtctctgaatccctcagtgtcaaaatataatgaaccctattttagaagtttcgatcgaattgattaaatttaaaacttttaacaaatgaatttcaan 507  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
8640125 aaggtctctgaatccctcagtgtcaaaatataatgaaccctattttagaagtttcgatcgaattgattaaatttaaaacttttaacaaatgaatttcaat 8640026  T
508 nnnnnnggcatgatagtgaaccctttaccatcatccttttgtcaagttcactttaaagttatttaaattcagacatgtttttccattgaatttgttgtat 607  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8640025 ttttttggcatgatagtgaaccctttaccatcatccttttgtcaagttcactttaaagttatttaaattcagacatgtttttccattgaatttgttgtat 8639926  T
608 gtgagtaggaataagtcccttttgttcaacttttaccattctatactcttaactcttaagtggttcaagagtttggcaacaaagttttaaccttatgtct 707  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8639925 gtgagtaggaataagtcccttttgttcaacttttaccattctatactcttaactcttaagtggttcaagagtttggcaacaaagttttaaccttatgtct 8639826  T
708 tgtgattcaaactgtccgactttcggctagttatttttaaaattttgcccaattg 762  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8639825 tgtgattcaaactgtccgactttcggctagttatttttaaaattttgcccaattg 8639771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 80; E-Value: 4e-37
Query Start/End: Original strand, 544 - 659
Target Start/End: Complemental strand, 8635771 - 8635656
Alignment:
544 ttttgtcaagttcactttaaagttatttaaattcagacatgtttttccattgaatttgttgtatgtgagtaggaataagtcccttttgttcaacttttac 643  Q
    |||||||||||||| |||||||||||||||||||||| ||||||| ||| | |||||||||||| |||||||| | |||||||||||||||||| |||||    
8635771 ttttgtcaagttcattttaaagttatttaaattcagaaatgttttcccagtcaatttgttgtatatgagtaggcacaagtcccttttgttcaacctttac 8635672  T
644 cattctatactcttaa 659  Q
    ||||||||||||||||    
8635671 cattctatactcttaa 8635656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 79; E-Value: 2e-36
Query Start/End: Original strand, 478 - 605
Target Start/End: Complemental strand, 8677100 - 8676973
Alignment:
478 atttaaaacttttaacaaatgaatttcaannnnnnnggcatgatagtgaaccctttaccatcatccttttgtcaagttcactttaaagttatttaaattc 577  Q
    |||||||||||||||||| ||||||||||       ||||||||| |||||||||||||||||||||||||||||||||||||| | |||||||||||||    
8677100 atttaaaacttttaacaattgaatttcaatttttttggcatgatattgaaccctttaccatcatccttttgtcaagttcactttgacgttatttaaattc 8677001  T
578 agacatgtttttccattgaatttgttgt 605  Q
    ||||||||||| || |||||||| ||||    
8677000 agacatgttttcccgttgaatttcttgt 8676973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 63; E-Value: 6e-27
Query Start/End: Original strand, 478 - 605
Target Start/End: Complemental strand, 8643082 - 8642955
Alignment:
478 atttaaaacttttaacaaatgaatttcaannnnnnnggcatgatagtgaaccctttaccatcatccttttgtcaagttcactttaaagttatttaaattc 577  Q
    |||||||||||||| ||| |||||||| |       ||||||||| || ||||||||||||||||||||||||||||||||||| |  ||||||||||||    
8643082 atttaaaacttttaccaattgaatttcgatttttttggcatgatattggaccctttaccatcatccttttgtcaagttcactttgacattatttaaattc 8642983  T
578 agacatgtttttccattgaatttgttgt 605  Q
    ||||||||||| || |||||||| ||||    
8642982 agacatgttttcccgttgaatttcttgt 8642955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 9002348 - 9002283
Alignment:
18 attggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatga 83  Q
    ||||||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||||||||    
9002348 attggtgttgttttgtataggtgtgcaaagtttaaattgcgtgaagaaaatgaagatcttgaatga 9002283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 8527924 - 8527858
Alignment:
18 attggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgat 84  Q
    |||||||||||||||||||||||||||||  ||||||||| ||||||| ||||||||||||||||||    
8527924 attggtgttattttatataggtgtgcaaatattaaattgcatgaagaagatgaagatcttgaatgat 8527858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 23 - 84
Target Start/End: Original strand, 9075335 - 9075396
Alignment:
23 tgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgat 84  Q
    |||||||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||    
9075335 tgttattttatataggtgtgcaaattttaaattgcatgaagagaatgaagatcttgaatgat 9075396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 216 - 306
Target Start/End: Complemental strand, 8643416 - 8643322
Alignment:
216 atgctaaatcagaattatgatatttc---aaaaaatgcatatctcattttaggatgcaaacaatgtc-tttttgtaagctttaattcagatgttc 306  Q
    ||||||||||| |||||| ||||||    |||||||||||||||||||||||||||||||  ||||| ||||||||| |||||||||||||||||    
8643416 atgctaaatcacaattatcatatttagaaaaaaaatgcatatctcattttaggatgcaaatgatgtcttttttgtaaactttaattcagatgttc 8643322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 8643573 - 8643507
Alignment:
18 attggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgat 84  Q
    ||||||||||||||||||||||||||||| ||||||||   |||| |||||||||||||||||||||    
8643573 attggtgttattttatataggtgtgcaaattttaaattatatgaaaaaaatgaagatcttgaatgat 8643507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 8636155 - 8636090
Alignment:
18 attggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatga 83  Q
    ||||| |||||||||||||||| |||||| ||||||||  ||||||||||||||||||||||||||    
8636155 attggcgttattttatataggtatgcaaattttaaattaagtgaagaaaatgaagatcttgaatga 8636090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 211 - 306
Target Start/End: Complemental strand, 8635998 - 8635895
Alignment:
211 ggttaatgctaaatcagaattatgatatttcaaa------aaatgcatatctcattttaggatgcaaacaatgtc--tttttgtaagctttaattcagat 302  Q
    |||| ||||||||||| ||||||||||||| |||      ||||||||||||||||||||||||||||  |||||  ||||||||| |||||||| ||||    
8635998 ggtttatgctaaatcacaattatgatatttgaaagaaaaaaaatgcatatctcattttaggatgcaaatgatgtctttttttgtaaactttaattaagat 8635899  T
303 gttc 306  Q
    ||||    
8635898 gttc 8635895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 514 - 575
Target Start/End: Complemental strand, 8533998 - 8533941
Alignment:
514 ggcatgatagtgaaccctttaccatcatccttttgtcaagttcactttaaagttatttaaat 575  Q
    ||||||||| ||||||||||||    |||||||||||| |||||||||||||||||||||||    
8533998 ggcatgatattgaaccctttac----atccttttgtcacgttcactttaaagttatttaaat 8533941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 78
Target Start/End: Complemental strand, 8534500 - 8534438
Alignment:
18 attggtgttattttatataggtgtgcaaa--atttaaattgcgtgaagaaaatgaagatcttg 78  Q
    |||||||||||||||||||||||| ||||   ||||| |||| ||||||||||||||||||||    
8534500 attggtgttattttatataggtgttcaaattttttaatttgcatgaagaaaatgaagatcttg 8534438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 516 - 558
Target Start/End: Original strand, 8549470 - 8549512
Alignment:
516 catgatagtgaaccctttaccatcatccttttgtcaagttcac 558  Q
    ||||||| ||||| |||||||||||||||||||||||||||||    
8549470 catgatattgaactctttaccatcatccttttgtcaagttcac 8549512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 20 - 84
Target Start/End: Complemental strand, 8420479 - 8420415
Alignment:
20 tggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgat 84  Q
    |||||||||||||||||||| |||||| ||  ||| | | ||||||||| |||||||||||||||    
8420479 tggtgttattttatataggtttgcaaagttagaatcgtgcgaagaaaataaagatcttgaatgat 8420415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 29 - 77
Target Start/End: Complemental strand, 8534751 - 8534703
Alignment:
29 tttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatctt 77  Q
    |||||||||||||||||| ||||||||||| |||||||| |||| ||||    
8534751 tttatataggtgtgcaaagtttaaattgcgggaagaaaaggaagttctt 8534703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 8549077 - 8549144
Alignment:
18 attggtgttattttatataggtgtgcaaaattt-aaattgcgtgaagaaaatgaagatcttgaatgat 84  Q
    |||||||||||||| |||||| ||||||| ||| ||||||| | |||||||  |||||||||||||||    
8549077 attggtgttattttgtataggcgtgcaaagtttaaaattgcataaagaaaacaaagatcttgaatgat 8549144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 72
Target Start/End: Complemental strand, 8640731 - 8640688
Alignment:
29 tttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaag 72  Q
    |||||||||||||||||| ||||||||| | |||||||||||||    
8640731 tttatataggtgtgcaaagtttaaattgggagaagaaaatgaag 8640688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 551 - 589
Target Start/End: Original strand, 9075780 - 9075818
Alignment:
551 aagttcactttaaagttatttaaattcagacatgttttt 589  Q
    ||||||||| |||||||||||||||||| ||||||||||    
9075780 aagttcactctaaagttatttaaattcacacatgttttt 9075818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 66
Target Start/End: Original strand, 1601079 - 1601116
Alignment:
29 tttatataggtgtgcaaaatttaaattgcgtgaagaaa 66  Q
    |||||||||||||||||| ||||||||||| |||||||    
1601079 tttatataggtgtgcaaagtttaaattgcgggaagaaa 1601116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 542 - 575
Target Start/End: Complemental strand, 8527392 - 8527359
Alignment:
542 ccttttgtcaagttcactttaaagttatttaaat 575  Q
    |||||||||| |||||||||||||||||||||||    
8527392 ccttttgtcacgttcactttaaagttatttaaat 8527359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 51; Significance: 8e-20; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 18 - 84
Target Start/End: Complemental strand, 9442091 - 9442025
Alignment:
18 attggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgat 84  Q
    |||||||||||||||||||||||||||||  ||||||| | ||||||||||||||||||||||||||    
9442091 attggtgttattttatataggtgtgcaaatattaaattacatgaagaaaatgaagatcttgaatgat 9442025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 542 - 575
Target Start/End: Complemental strand, 9441726 - 9441693
Alignment:
542 ccttttgtcaagttcactttaaagttatttaaat 575  Q
    |||||||||| |||||||||||||||||||||||    
9441726 ccttttgtcacgttcactttaaagttatttaaat 9441693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 26 - 79
Target Start/End: Original strand, 26324948 - 26325001
Alignment:
26 tattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttga 79  Q
    |||||||||||||||||||||||| || |||| |||||||||||||||||||||    
26324948 tattttatataggtgtgcaaaattgaatttgcatgaagaaaatgaagatcttga 26325001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 5129853 - 5129794
Alignment:
18 attggtgttattttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatctt 77  Q
    |||||| |||||||||||||||||||||| |||||  |||| |||  |||||||||||||    
5129853 attggtcttattttatataggtgtgcaaattttaatctgcgagaaagaaatgaagatctt 5129794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 72
Target Start/End: Complemental strand, 5130119 - 5130076
Alignment:
29 tttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaag 72  Q
    |||||| ||||||||||| ||||||||||| |||||||||||||    
5130119 tttatacaggtgtgcaaagtttaaattgcgggaagaaaatgaag 5130076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 29 - 84
Target Start/End: Original strand, 48362774 - 48362829
Alignment:
29 tttatataggtgtgcaaaatttaaattgcgtgaagaaaatgaagatcttgaatgat 84  Q
    ||||||||||||||||||  ||||||| | |||||||||||||||||| |||||||    
48362774 tttatataggtgtgcaaatattaaattacatgaagaaaatgaagatctcgaatgat 48362829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0627 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0627
Description:

Target: scaffold0627; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 67
Target Start/End: Complemental strand, 3811 - 3774
Alignment:
30 ttatataggtgtgcaaaatttaaattgcgtgaagaaaa 67  Q
    ||||||||||||| ||| ||||||||||||||||||||    
3811 ttatataggtgtggaaagtttaaattgcgtgaagaaaa 3774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 93648 times since January 2019
Visitors: 2365