View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-16 (Length: 153)

Name: F9164J-LTR4-TNT-insertion-16
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-16
F9164J-LTR4-TNT-insertion-16
[»] chr4 (1 HSPs)
chr4 (8-144)||(23267495-23267631)


Alignment Details
Target: chr4 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 144
Target Start/End: Complemental strand, 23267631 - 23267495
Alignment:
8 ctaagcacaagccaattatatataacccaaagactcttacgaatctcgtgattttaaatttcaactttcaaatatannnnnnncttcaaaaaacatgtta 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||    
23267631 ctaagcacaagccaattatatataacccaaagactcttacgaatctcgtgattttaaatttcaactttcaaatatatttttttcttcaaaaaacatgtta 23267532  T
108 aatgtattttcttatggaattaaatgcactgcaattg 144  Q
    |||||||||||||||||||||||||||||||||||||    
23267531 aatgtattttcttatggaattaaatgcactgcaattg 23267495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199778 times since January 2019
Visitors: 908