View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-17 (Length: 206)

Name: F9164J-LTR4-TNT-insertion-17
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-17
F9164J-LTR4-TNT-insertion-17
[»] scaffold0608 (2 HSPs)
scaffold0608 (9-198)||(2112-2301)
scaffold0608 (9-193)||(8058-8242)
[»] chr1 (4 HSPs)
chr1 (9-198)||(11112620-11112809)
chr1 (9-193)||(11106677-11106861)
chr1 (9-174)||(46927230-46927395)
chr1 (86-173)||(46934101-46934188)


Alignment Details
Target: scaffold0608 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: scaffold0608
Description:

Target: scaffold0608; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 198
Target Start/End: Original strand, 2112 - 2301
Alignment:
9 gggagatcagagatatttgactcttcaagtggcacaccgcacccgatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2112 gggagatcagagatatttgactcttcaagtggcacaccgcacccgatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 2211  T
109 gctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctatatagagtaaaccataactcacatta 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2212 gctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctatatagagtaaaccataactcacatta 2301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0608; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 9 - 193
Target Start/End: Complemental strand, 8242 - 8058
Alignment:
9 gggagatcagagatatttgactcttcaagtggcacaccgcacccgatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 108  Q
    ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8242 gggagattagagatatttgactcttcaagtggcacaccgcacccaatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 8143  T
109 gctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctatatagagtaaaccataactca 193  Q
    |||||| ||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||| || |||||||||    
8142 gctccgccattgcccattctaatgttgatgttgttgtatctgttccggcaacaaatatatcctatatagagttaaacataactca 8058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 9 - 198
Target Start/End: Complemental strand, 11112809 - 11112620
Alignment:
9 gggagatcagagatatttgactcttcaagtggcacaccgcacccgatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11112809 gggagatcagagatatttgactcttcaagtggcacaccgcacccgatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 11112710  T
109 gctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctatatagagtaaaccataactcacatta 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11112709 gctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctatatagagtaaaccataactcacatta 11112620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 9 - 193
Target Start/End: Original strand, 11106677 - 11106861
Alignment:
9 gggagatcagagatatttgactcttcaagtggcacaccgcacccgatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 108  Q
    ||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11106677 gggagattagagatatttgactcttcaagtggcacaccgcacccaatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 11106776  T
109 gctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctatatagagtaaaccataactca 193  Q
    |||||| ||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||| || |||||||||    
11106777 gctccgccattgcccattctaatgttgatgttgttgtatctgttccggcaacaaatatatcctatatagagttaaacataactca 11106861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 9 - 174
Target Start/End: Complemental strand, 46927395 - 46927230
Alignment:
9 gggagatcagagatatttgactcttcaagtggcacaccgcacccgatcgtttcttccaactctttcttagcttttcgcatagcttcaggattgttgataa 108  Q
    ||||| |||| ||||||||||||||||||||||||||| ||||| || ||||  | |||||||||||| |||||| |||| ||||| ||||||   ||||    
46927395 gggagctcagtgatatttgactcttcaagtggcacaccacacccaattgtttgcttcaactctttcttggctttttgcatcgcttctggattgcgaataa 46927296  T
109 gctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctata 174  Q
    |||| |||||||||||||||| ||||||||| || ||||||||||| |||||||||||||||||||    
46927295 gctctgtcattgcccattctagtgttgatgtcgttgtatccgttccagcaacaaatatatcctata 46927230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 86 - 173
Target Start/End: Complemental strand, 46934188 - 46934101
Alignment:
86 catagcttcaggattgttgataagctccgtcattgcccattctaatgttgatgttgtagtatccgttcccgcaacaaatatatcctat 173  Q
    ||||||||| || |||  ||||||||| ||||| |||||||| |  || |||| ||| ||||| |||||||||||||||| |||||||    
46934188 catagcttctgggttgcggataagctctgtcatcgcccattcgagggtggatgctgttgtatctgttcccgcaacaaatagatcctat 46934101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC