View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-2 (Length: 396)

Name: F9164J-LTR4-TNT-insertion-2
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-2
F9164J-LTR4-TNT-insertion-2
[»] chr2 (2 HSPs)
chr2 (8-396)||(45631924-45632310)
chr2 (210-263)||(42848321-42848374)


Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 396
Target Start/End: Original strand, 45631924 - 45632310
Alignment:
8 tctatcaccgtcacaaaatcattaggttcagtgtgtgaattgatggagaggaacccaagaaggagcagcacgtttcaagagaagaggaaaacagtagaaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45631924 tctatcaccgtcacaaaatcattaggttcagtgtgtgaattgatggagaggaacccaagaaggagcagcacgtttcaagagaagaggaaaacagtagaaa 45632023  T
108 ggctaattgaggaaattagatacctcaaaacaggatgaacaaatcttcatcaatttctgtttccacatatgcaacaaatcttcattaaaacagannnnnn 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
45632024 ggctaattgaggaaattagatacctcaaaacaggatgaacaaatcttcatcaatttctgtttccacatatgcaacaaatcttcattaaaacagatttttt 45632123  T
208 nncttctttttaatgatgctaatcataaaccatggaggaggaagaattgggtaatgatnnnnnnnnnnnnnnnnnnttattcaaaattggctatcacata 307  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||    
45632124 ttcttctttttaatgatgctaatcataaaccatggaggaggaagaattgggtaatgat--aaaaaaaaaaaaaaaattattcaaaattggctatcacata 45632221  T
308 tcctacttttgattacaatgatgatgatagtgaaattaaaactatgnnnnnnnnnnnnncacagaaagagattacccgtgagagagaga 396  Q
    |||||||||||||||| |||||||||||||||||||||| ||||||             ||||||||||||||||||||||||||||||    
45632222 tcctacttttgattacgatgatgatgatagtgaaattaagactatgagaagaagagaaacacagaaagagattacccgtgagagagaga 45632310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 210 - 263
Target Start/End: Original strand, 42848321 - 42848374
Alignment:
210 cttctttttaatgatgctaatcataaaccatggaggaggaagaattgggtaatg 263  Q
    ||||||||| |||||||| ||  | ||||||||| |||||||||||||||||||    
42848321 cttcttttttatgatgcttatagtgaaccatggaagaggaagaattgggtaatg 42848374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC