View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-2 (Length: 396)

Name: F9164J-LTR4-TNT-insertion-2
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-2
[»] chr2 (2 HSPs)
chr2 (8-396)||(45631924-45632310)
chr2 (210-263)||(42848321-42848374)

Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 2)
Name: chr2

Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 8 - 396
Target Start/End: Original strand, 45631924 - 45632310
8 tctatcaccgtcacaaaatcattaggttcagtgtgtgaattgatggagaggaacccaagaaggagcagcacgtttcaagagaagaggaaaacagtagaaa 107  Q
45631924 tctatcaccgtcacaaaatcattaggttcagtgtgtgaattgatggagaggaacccaagaaggagcagcacgtttcaagagaagaggaaaacagtagaaa 45632023  T
108 ggctaattgaggaaattagatacctcaaaacaggatgaacaaatcttcatcaatttctgtttccacatatgcaacaaatcttcattaaaacagannnnnn 207  Q
45632024 ggctaattgaggaaattagatacctcaaaacaggatgaacaaatcttcatcaatttctgtttccacatatgcaacaaatcttcattaaaacagatttttt 45632123  T
208 nncttctttttaatgatgctaatcataaaccatggaggaggaagaattgggtaatgatnnnnnnnnnnnnnnnnnnttattcaaaattggctatcacata 307  Q
      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||    
45632124 ttcttctttttaatgatgctaatcataaaccatggaggaggaagaattgggtaatgat--aaaaaaaaaaaaaaaattattcaaaattggctatcacata 45632221  T
308 tcctacttttgattacaatgatgatgatagtgaaattaaaactatgnnnnnnnnnnnnncacagaaagagattacccgtgagagagaga 396  Q
    |||||||||||||||| |||||||||||||||||||||| ||||||             ||||||||||||||||||||||||||||||    
45632222 tcctacttttgattacgatgatgatgatagtgaaattaagactatgagaagaagagaaacacagaaagagattacccgtgagagagaga 45632310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 210 - 263
Target Start/End: Original strand, 42848321 - 42848374
210 cttctttttaatgatgctaatcataaaccatggaggaggaagaattgggtaatg 263  Q
    ||||||||| |||||||| ||  | ||||||||| |||||||||||||||||||    
42848321 cttcttttttatgatgcttatagtgaaccatggaagaggaagaattgggtaatg 42848374  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 199842 times since January 2019
Visitors: 908