View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-3 (Length: 338)

Name: F9164J-LTR4-TNT-insertion-3
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-3
F9164J-LTR4-TNT-insertion-3
[»] chr4 (1 HSPs)
chr4 (10-329)||(49357176-49357495)
[»] chr6 (1 HSPs)
chr6 (10-329)||(14349281-14349600)


Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 329
Target Start/End: Original strand, 49357176 - 49357495
Alignment:
10 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattnnnnnnnnnnn 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||               
49357176 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattaaaaaagaaaa 49357275  T
110 nnnnnncgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggctaga 209  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49357276 acaaaacgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggctaga 49357375  T
210 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49357376 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 49357475  T
310 cggttggagcaggtcaattg 329  Q
    ||||||||||||||||||||    
49357476 cggttggagcaggtcaattg 49357495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 10 - 329
Target Start/End: Complemental strand, 14349600 - 14349281
Alignment:
10 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattnnnnnnnnnnn 109  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||               
14349600 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattaaaaaagaaaa 14349501  T
110 nnnnnncgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggctaga 209  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
14349500 acaaaacgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggcttga 14349401  T
210 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14349400 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 14349301  T
310 cggttggagcaggtcaattg 329  Q
    ||||||||||||||||||||    
14349300 cggttggagcaggtcaattg 14349281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC