View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-3 (Length: 338)

Name: F9164J-LTR4-TNT-insertion-3
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-3
[»] chr4 (1 HSPs)
chr4 (10-329)||(49357176-49357495)
[»] chr6 (1 HSPs)
chr6 (10-329)||(14349281-14349600)

Alignment Details
Target: chr4 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 10 - 329
Target Start/End: Original strand, 49357176 - 49357495
10 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattnnnnnnnnnnn 109  Q
49357176 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattaaaaaagaaaa 49357275  T
110 nnnnnncgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggctaga 209  Q
49357276 acaaaacgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggctaga 49357375  T
210 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 309  Q
49357376 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 49357475  T
310 cggttggagcaggtcaattg 329  Q
49357476 cggttggagcaggtcaattg 49357495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 10 - 329
Target Start/End: Complemental strand, 14349600 - 14349281
10 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattnnnnnnnnnnn 109  Q
14349600 attttgttgattatgcatatttgctatgcaagctgagaaacctttaccttttcttactattatcactagaaatagttttaggccaaattaaaaaagaaaa 14349501  T
110 nnnnnncgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggctaga 209  Q
          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
14349500 acaaaacgtttcaacctaattaatctgaggccactctaagaaaattaaaattaaccaaattgaagatatagaatttctgtgtagatctattgaggcttga 14349401  T
210 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 309  Q
14349400 ctcggtggatataccctcattgaatgcatcctgcatattttctatgaaagctgaaagtacaccttttatttgagaaattagtaactaaagtgatggtaac 14349301  T
310 cggttggagcaggtcaattg 329  Q
14349300 cggttggagcaggtcaattg 14349281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 94932 times since January 2019
Visitors: 2222