View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-4 (Length: 347)

Name: F9164J-LTR4-TNT-insertion-4
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-4
F9164J-LTR4-TNT-insertion-4
[»] chr5 (1 HSPs)
chr5 (3-337)||(335157-335491)
[»] chr1 (1 HSPs)
chr1 (69-127)||(48013459-48013516)


Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 3 - 337
Target Start/End: Complemental strand, 335491 - 335157
Alignment:
3 caacatcaccatcatcaactcaaataaagattctattactatgcatgcaattacaatgaagagtgtaaaaataatttggggcacagtgtagttgactggg 102  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
335491 caacaccaccatcatcaactcaaataaagattctattactatgcatgcaattacaatgaagagtgtaaaaataatttggggcacagtgtagttgactggg 335392  T
103 atttttatgaatccacatgcaatcacattcacttacaagaattaccagtcagaattcacagaagcatgtgagcacgtgtgcataattttcatatgcgggc 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
335391 atttttatgaatccacatgcaatcacattcacttacaagaattaccagtcagaattcacagaagcatgtgagcacgtgtgcataattttcatatgcgggc 335292  T
203 ttccatatattcaaacacatgtttgcacgtgcacatgcacttctatctatacctctctcgtgtagtagtatactattattcttttcaactacaaaatgta 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
335291 ttccatatattcaaacacatgtttgcacgtgcacatgcacttctatctatacctctctcgtgtagtagtatactattattcttttcaactacaaaatgta 335192  T
303 cggtgtttattacgggttattatcaaaatttatta 337  Q
    |||||||||||||||||||||||||||||||||||    
335191 cggtgtttattacgggttattatcaaaatttatta 335157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 127
Target Start/End: Original strand, 48013459 - 48013516
Alignment:
69 aaaaataatttggggcacagtgtagttgactgggatttttatgaatccacatgcaatca 127  Q
    ||||| ||||| |||||| ||| |||||||||||| |||||| ||||||||||||||||    
48013459 aaaaaaaatttagggcacggtgcagttgactggga-ttttattaatccacatgcaatca 48013516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC