View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-4 (Length: 347)

Name: F9164J-LTR4-TNT-insertion-4
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-4
[»] chr5 (1 HSPs)
chr5 (3-337)||(335157-335491)
[»] chr1 (1 HSPs)
chr1 (69-127)||(48013459-48013516)

Alignment Details
Target: chr5 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 3 - 337
Target Start/End: Complemental strand, 335491 - 335157
3 caacatcaccatcatcaactcaaataaagattctattactatgcatgcaattacaatgaagagtgtaaaaataatttggggcacagtgtagttgactggg 102  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
335491 caacaccaccatcatcaactcaaataaagattctattactatgcatgcaattacaatgaagagtgtaaaaataatttggggcacagtgtagttgactggg 335392  T
103 atttttatgaatccacatgcaatcacattcacttacaagaattaccagtcagaattcacagaagcatgtgagcacgtgtgcataattttcatatgcgggc 202  Q
335391 atttttatgaatccacatgcaatcacattcacttacaagaattaccagtcagaattcacagaagcatgtgagcacgtgtgcataattttcatatgcgggc 335292  T
203 ttccatatattcaaacacatgtttgcacgtgcacatgcacttctatctatacctctctcgtgtagtagtatactattattcttttcaactacaaaatgta 302  Q
335291 ttccatatattcaaacacatgtttgcacgtgcacatgcacttctatctatacctctctcgtgtagtagtatactattattcttttcaactacaaaatgta 335192  T
303 cggtgtttattacgggttattatcaaaatttatta 337  Q
335191 cggtgtttattacgggttattatcaaaatttatta 335157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 69 - 127
Target Start/End: Original strand, 48013459 - 48013516
69 aaaaataatttggggcacagtgtagttgactgggatttttatgaatccacatgcaatca 127  Q
    ||||| ||||| |||||| ||| |||||||||||| |||||| ||||||||||||||||    
48013459 aaaaaaaatttagggcacggtgcagttgactggga-ttttattaatccacatgcaatca 48013516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 199748 times since January 2019
Visitors: 908