View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-5 (Length: 472)

Name: F9164J-LTR4-TNT-insertion-5
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-5
[»] chr4 (4 HSPs)
chr4 (10-462)||(54414002-54414454)
chr4 (419-456)||(9302652-9302689)
chr4 (422-459)||(47416529-47416566)
chr4 (417-453)||(24238904-24238940)
[»] chr3 (2 HSPs)
chr3 (419-458)||(55318079-55318118)
chr3 (417-458)||(51017851-51017892)
[»] chr2 (4 HSPs)
chr2 (412-455)||(4529750-4529793)
chr2 (417-457)||(36413823-36413863)
chr2 (420-456)||(407542-407578)
chr2 (410-458)||(1244631-1244679)
[»] chr7 (1 HSPs)
chr7 (412-460)||(35498457-35498505)
[»] chr1 (5 HSPs)
chr1 (410-458)||(33844679-33844727)
chr1 (410-458)||(33949251-33949299)
chr1 (411-458)||(12553256-12553303)
chr1 (412-458)||(9976371-9976417)
chr1 (419-455)||(24889205-24889241)
[»] chr5 (2 HSPs)
chr5 (410-456)||(38361549-38361595)
chr5 (420-456)||(32252914-32252950)
[»] scaffold0011 (1 HSPs)
scaffold0011 (422-459)||(19392-19429)
[»] chr8 (1 HSPs)
chr8 (410-459)||(25470831-25470880)

Alignment Details
Target: chr4 (Bit Score: 453; Significance: 0; HSPs: 4)
Name: chr4

Target: chr4; HSP #1
Raw Score: 453; E-Value: 0
Query Start/End: Original strand, 10 - 462
Target Start/End: Complemental strand, 54414454 - 54414002
10 ttgcacgtttaaagagaacatagcggtatccgcgttgaaccttgagtttctttcagatcttctttgaggcgtagaatctcttgcttcctttccttagcct 109  Q
54414454 ttgcacgtttaaagagaacatagcggtatccgcgttgaaccttgagtttctttcagatcttctttgaggcgtagaatctcttgcttcctttccttagcct 54414355  T
110 aagaatcaaaacacgagattcaagttaaaaacgcattggatttttcagaagaaaagagagaagagtagtttcgatgaacctttcgtttccaacggagaag 209  Q
54414354 aagaatcaaaacacgagattcaagttaaaaacgcattggatttttcagaagaaaagagagaagagtagtttcgatgaacctttcgtttccaacggagaag 54414255  T
210 attttccgattgagaaggagagatagcattggaggagtgtttagtgtttttgataaacttagaacggagaagtgaaatcgctacggcaagtttcatagat 309  Q
54414254 attttccgattgagaaggagagatagcattggaggagtgtttagtgtttttgataaacttagaacggagaagtgaaatcgctacggcaagtttcatagat 54414155  T
310 tcatcactcgttgcggcatttccaacctccgtcatttcctttcagattcgaaatgaaaaacgcgccaaacctattagagcctctcttttcctgtaaactt 409  Q
54414154 tcatcactcgttgcggcatttccaacctccgtcatttcctttcagattcgaaatgaaaaacgcgccaaacctattagagcctctcttttcctgtaaactt 54414055  T
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccgaatt 462  Q
54414054 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccgaatt 54414002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 456
Target Start/End: Original strand, 9302652 - 9302689
419 taaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    |||||||||| |||||||| ||||||||||||||||||    
9302652 taaaattcacctttttcaaggtgaataaatggggtgtc 9302689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 459
Target Start/End: Complemental strand, 47416566 - 47416529
422 aattcacttttttcaaagtgaataaatggggtgtccga 459  Q
    ||||||| ||||||||||||||||| ||||||||||||    
47416566 aattcacctttttcaaagtgaataagtggggtgtccga 47416529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 417 - 453
Target Start/End: Original strand, 24238904 - 24238940
417 gctaaaattcacttttttcaaagtgaataaatggggt 453  Q
    |||| ||||||||||||||||||| ||||||||||||    
24238904 gctataattcacttttttcaaagtaaataaatggggt 24238940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 419 - 458
Target Start/End: Complemental strand, 55318118 - 55318079
419 taaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||||||||||||||||||||||||| |||||||||||    
55318118 taaaattcacttttttcaaagtgaataagtggggtgtccg 55318079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 417 - 458
Target Start/End: Complemental strand, 51017892 - 51017851
417 gctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||| ||||||||||||||||||||||||| |||||||||||    
51017892 gctagaattcacttttttcaaagtgaataagtggggtgtccg 51017851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr2

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 412 - 455
Target Start/End: Original strand, 4529750 - 4529793
412 tagttgctaaaattcacttttttcaaagtgaataaatggggtgt 455  Q
    ||||||||||||||||| ||||||||||||||||| ||||||||    
4529750 tagttgctaaaattcacctttttcaaagtgaataagtggggtgt 4529793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 36413863 - 36413823
417 gctaaaattcacttttttcaaagtgaataaatggggtgtcc 457  Q
    |||||||||||| ||||||||||||||||| ||||||||||    
36413863 gctaaaattcacctttttcaaagtgaataagtggggtgtcc 36413823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 420 - 456
Target Start/End: Complemental strand, 407578 - 407542
420 aaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    ||||||||||||||||||  |||||||||||||||||    
407578 aaaattcacttttttcaagctgaataaatggggtgtc 407542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 410 - 458
Target Start/End: Complemental strand, 1244679 - 1244631
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||| |||| ||||||| |||||||| |||||||| |||||||||||    
1244679 tctagtggctagaattcacctttttcaaggtgaataagtggggtgtccg 1244631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr7

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 412 - 460
Target Start/End: Complemental strand, 35498505 - 35498457
412 tagttgctaaaattcacttttttcaaagtgaataaatggggtgtccgaa 460  Q
    |||| |||| ||||||| ||||||||||||||||| |||||||||||||    
35498505 tagtggctagaattcacctttttcaaagtgaataagtggggtgtccgaa 35498457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 5)
Name: chr1

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 410 - 458
Target Start/End: Complemental strand, 33844727 - 33844679
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||| |||| ||||||| ||||||||||||||||| |||||||||||    
33844727 tctagtggctataattcacctttttcaaagtgaataagtggggtgtccg 33844679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 410 - 458
Target Start/End: Original strand, 33949251 - 33949299
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||| |||| ||||||| ||||||||||||||||| |||||||||||    
33949251 tctagtggctataattcacctttttcaaagtgaataagtggggtgtccg 33949299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 458
Target Start/End: Complemental strand, 12553303 - 12553256
411 ctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    ||||| |||| ||||||| ||||||||||||||||| |||||||||||    
12553303 ctagtggctagaattcacctttttcaaagtgaataagtggggtgtccg 12553256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 412 - 458
Target Start/End: Original strand, 9976371 - 9976417
412 tagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||| |||| |||||||||||||||| |||||||| |||||||||||    
9976371 tagtggctagaattcacttttttcaaggtgaataagtggggtgtccg 9976417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 419 - 455
Target Start/End: Complemental strand, 24889241 - 24889205
419 taaaattcacttttttcaaagtgaataaatggggtgt 455  Q
    |||||||||| ||||||||||||||||| ||||||||    
24889241 taaaattcacctttttcaaagtgaataagtggggtgt 24889205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr5

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 410 - 456
Target Start/End: Complemental strand, 38361595 - 38361549
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    ||||||||||| ||||||| |||||||| | ||||||||||||||||    
38361595 tctagttgctagaattcacatttttcaaggagaataaatggggtgtc 38361549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 420 - 456
Target Start/End: Original strand, 32252914 - 32252950
420 aaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    ||||||||| ||||||||||||||||||| |||||||    
32252914 aaaattcacatttttcaaagtgaataaattgggtgtc 32252950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0011

Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 459
Target Start/End: Original strand, 19392 - 19429
422 aattcacttttttcaaagtgaataaatggggtgtccga 459  Q
    ||||||| |||||||||||||||||||| |||||||||    
19392 aattcacctttttcaaagtgaataaatgaggtgtccga 19429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 410 - 459
Target Start/End: Original strand, 25470831 - 25470880
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccga 459  Q
    |||||| |||| ||||||| || ||||| |||||||||||||||||||||    
25470831 tctagtggctagaattcaccttcttcaaggtgaataaatggggtgtccga 25470880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC