View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-5 (Length: 472)

Name: F9164J-LTR4-TNT-insertion-5
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-5
F9164J-LTR4-TNT-insertion-5
[»] chr4 (4 HSPs)
chr4 (10-462)||(54414002-54414454)
chr4 (419-456)||(9302652-9302689)
chr4 (422-459)||(47416529-47416566)
chr4 (417-453)||(24238904-24238940)
[»] chr3 (2 HSPs)
chr3 (419-458)||(55318079-55318118)
chr3 (417-458)||(51017851-51017892)
[»] chr2 (4 HSPs)
chr2 (412-455)||(4529750-4529793)
chr2 (417-457)||(36413823-36413863)
chr2 (420-456)||(407542-407578)
chr2 (410-458)||(1244631-1244679)
[»] chr7 (1 HSPs)
chr7 (412-460)||(35498457-35498505)
[»] chr1 (5 HSPs)
chr1 (410-458)||(33844679-33844727)
chr1 (410-458)||(33949251-33949299)
chr1 (411-458)||(12553256-12553303)
chr1 (412-458)||(9976371-9976417)
chr1 (419-455)||(24889205-24889241)
[»] chr5 (2 HSPs)
chr5 (410-456)||(38361549-38361595)
chr5 (420-456)||(32252914-32252950)
[»] scaffold0011 (1 HSPs)
scaffold0011 (422-459)||(19392-19429)
[»] chr8 (1 HSPs)
chr8 (410-459)||(25470831-25470880)


Alignment Details
Target: chr4 (Bit Score: 453; Significance: 0; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 453; E-Value: 0
Query Start/End: Original strand, 10 - 462
Target Start/End: Complemental strand, 54414454 - 54414002
Alignment:
10 ttgcacgtttaaagagaacatagcggtatccgcgttgaaccttgagtttctttcagatcttctttgaggcgtagaatctcttgcttcctttccttagcct 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54414454 ttgcacgtttaaagagaacatagcggtatccgcgttgaaccttgagtttctttcagatcttctttgaggcgtagaatctcttgcttcctttccttagcct 54414355  T
110 aagaatcaaaacacgagattcaagttaaaaacgcattggatttttcagaagaaaagagagaagagtagtttcgatgaacctttcgtttccaacggagaag 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54414354 aagaatcaaaacacgagattcaagttaaaaacgcattggatttttcagaagaaaagagagaagagtagtttcgatgaacctttcgtttccaacggagaag 54414255  T
210 attttccgattgagaaggagagatagcattggaggagtgtttagtgtttttgataaacttagaacggagaagtgaaatcgctacggcaagtttcatagat 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54414254 attttccgattgagaaggagagatagcattggaggagtgtttagtgtttttgataaacttagaacggagaagtgaaatcgctacggcaagtttcatagat 54414155  T
310 tcatcactcgttgcggcatttccaacctccgtcatttcctttcagattcgaaatgaaaaacgcgccaaacctattagagcctctcttttcctgtaaactt 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54414154 tcatcactcgttgcggcatttccaacctccgtcatttcctttcagattcgaaatgaaaaacgcgccaaacctattagagcctctcttttcctgtaaactt 54414055  T
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccgaatt 462  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
54414054 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccgaatt 54414002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 419 - 456
Target Start/End: Original strand, 9302652 - 9302689
Alignment:
419 taaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    |||||||||| |||||||| ||||||||||||||||||    
9302652 taaaattcacctttttcaaggtgaataaatggggtgtc 9302689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 459
Target Start/End: Complemental strand, 47416566 - 47416529
Alignment:
422 aattcacttttttcaaagtgaataaatggggtgtccga 459  Q
    ||||||| ||||||||||||||||| ||||||||||||    
47416566 aattcacctttttcaaagtgaataagtggggtgtccga 47416529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 417 - 453
Target Start/End: Original strand, 24238904 - 24238940
Alignment:
417 gctaaaattcacttttttcaaagtgaataaatggggt 453  Q
    |||| ||||||||||||||||||| ||||||||||||    
24238904 gctataattcacttttttcaaagtaaataaatggggt 24238940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000004; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 419 - 458
Target Start/End: Complemental strand, 55318118 - 55318079
Alignment:
419 taaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||||||||||||||||||||||||| |||||||||||    
55318118 taaaattcacttttttcaaagtgaataagtggggtgtccg 55318079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 417 - 458
Target Start/End: Complemental strand, 51017892 - 51017851
Alignment:
417 gctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||| ||||||||||||||||||||||||| |||||||||||    
51017892 gctagaattcacttttttcaaagtgaataagtggggtgtccg 51017851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000004; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 412 - 455
Target Start/End: Original strand, 4529750 - 4529793
Alignment:
412 tagttgctaaaattcacttttttcaaagtgaataaatggggtgt 455  Q
    ||||||||||||||||| ||||||||||||||||| ||||||||    
4529750 tagttgctaaaattcacctttttcaaagtgaataagtggggtgt 4529793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 417 - 457
Target Start/End: Complemental strand, 36413863 - 36413823
Alignment:
417 gctaaaattcacttttttcaaagtgaataaatggggtgtcc 457  Q
    |||||||||||| ||||||||||||||||| ||||||||||    
36413863 gctaaaattcacctttttcaaagtgaataagtggggtgtcc 36413823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 420 - 456
Target Start/End: Complemental strand, 407578 - 407542
Alignment:
420 aaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    ||||||||||||||||||  |||||||||||||||||    
407578 aaaattcacttttttcaagctgaataaatggggtgtc 407542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 410 - 458
Target Start/End: Complemental strand, 1244679 - 1244631
Alignment:
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||| |||| ||||||| |||||||| |||||||| |||||||||||    
1244679 tctagtggctagaattcacctttttcaaggtgaataagtggggtgtccg 1244631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 412 - 460
Target Start/End: Complemental strand, 35498505 - 35498457
Alignment:
412 tagttgctaaaattcacttttttcaaagtgaataaatggggtgtccgaa 460  Q
    |||| |||| ||||||| ||||||||||||||||| |||||||||||||    
35498505 tagtggctagaattcacctttttcaaagtgaataagtggggtgtccgaa 35498457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000003; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 410 - 458
Target Start/End: Complemental strand, 33844727 - 33844679
Alignment:
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||| |||| ||||||| ||||||||||||||||| |||||||||||    
33844727 tctagtggctataattcacctttttcaaagtgaataagtggggtgtccg 33844679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 410 - 458
Target Start/End: Original strand, 33949251 - 33949299
Alignment:
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||||| |||| ||||||| ||||||||||||||||| |||||||||||    
33949251 tctagtggctataattcacctttttcaaagtgaataagtggggtgtccg 33949299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 411 - 458
Target Start/End: Complemental strand, 12553303 - 12553256
Alignment:
411 ctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    ||||| |||| ||||||| ||||||||||||||||| |||||||||||    
12553303 ctagtggctagaattcacctttttcaaagtgaataagtggggtgtccg 12553256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 412 - 458
Target Start/End: Original strand, 9976371 - 9976417
Alignment:
412 tagttgctaaaattcacttttttcaaagtgaataaatggggtgtccg 458  Q
    |||| |||| |||||||||||||||| |||||||| |||||||||||    
9976371 tagtggctagaattcacttttttcaaggtgaataagtggggtgtccg 9976417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 419 - 455
Target Start/End: Complemental strand, 24889241 - 24889205
Alignment:
419 taaaattcacttttttcaaagtgaataaatggggtgt 455  Q
    |||||||||| ||||||||||||||||| ||||||||    
24889241 taaaattcacctttttcaaagtgaataagtggggtgt 24889205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 410 - 456
Target Start/End: Complemental strand, 38361595 - 38361549
Alignment:
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    ||||||||||| ||||||| |||||||| | ||||||||||||||||    
38361595 tctagttgctagaattcacatttttcaaggagaataaatggggtgtc 38361549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 420 - 456
Target Start/End: Original strand, 32252914 - 32252950
Alignment:
420 aaaattcacttttttcaaagtgaataaatggggtgtc 456  Q
    ||||||||| ||||||||||||||||||| |||||||    
32252914 aaaattcacatttttcaaagtgaataaattgggtgtc 32252950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 422 - 459
Target Start/End: Original strand, 19392 - 19429
Alignment:
422 aattcacttttttcaaagtgaataaatggggtgtccga 459  Q
    ||||||| |||||||||||||||||||| |||||||||    
19392 aattcacctttttcaaagtgaataaatgaggtgtccga 19429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 410 - 459
Target Start/End: Original strand, 25470831 - 25470880
Alignment:
410 tctagttgctaaaattcacttttttcaaagtgaataaatggggtgtccga 459  Q
    |||||| |||| ||||||| || ||||| |||||||||||||||||||||    
25470831 tctagtggctagaattcaccttcttcaaggtgaataaatggggtgtccga 25470880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105608 times since January 2019
Visitors: 2328