View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-6 (Length: 244)

Name: F9164J-LTR4-TNT-insertion-6
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-6
F9164J-LTR4-TNT-insertion-6
[»] chr1 (1 HSPs)
chr1 (8-186)||(9976158-9976336)
[»] chr7 (1 HSPs)
chr7 (8-46)||(7112472-7112510)


Alignment Details
Target: chr1 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 8 - 186
Target Start/End: Original strand, 9976158 - 9976336
Alignment:
8 attcattgcattaagttcaatgaacaagtttagcagcaagccatcaataactgtgttgaaagcctcttagaacaagagctaaagtaaaaggcatattgaa 107  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9976158 attcattgcattaaattcaatgaacaagtttagcagcaagccatcaataactgtgttgaaagcctcttagaacaagagctaaagtaaaaggcatattgaa 9976257  T
108 tctatcaatatgaaccttcatggttgagcgaaggatgagtttatgtgggaaattcacatacctaaagttagaattcttg 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9976258 tctatcaatatgaaccttcatggttgagcgaaggatgagtttatgtgggaaattcacatacctaaagttagaattcttg 9976336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 7112510 - 7112472
Alignment:
8 attcattgcattaagttcaatgaacaagtttagcagcaa 46  Q
    |||||||||||||| ||||||||||| ||||||||||||    
7112510 attcattgcattaaattcaatgaacaggtttagcagcaa 7112472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199843 times since January 2019
Visitors: 908