View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-7 (Length: 579)

Name: F9164J-LTR4-TNT-insertion-7
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-7
F9164J-LTR4-TNT-insertion-7
[»] chr4 (2 HSPs)
chr4 (25-296)||(42509631-42509902)
chr4 (339-464)||(42509945-42510070)
[»] chr6 (1 HSPs)
chr6 (384-433)||(31765601-31765650)


Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 25 - 296
Target Start/End: Original strand, 42509631 - 42509902
Alignment:
25 ttatcaaattattctttcattttattttataaaaacnnnnnnncagagattgttatatgagaatttgttctaagaaaggtataaaatgcgacttcgtgta 124  Q
    ||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
42509631 ttatcaaattattctttcattttattttataaaaactttttttcagagattgttatatgagaatttgttctaagaaaggtataaaatgagacttcgtgta 42509730  T
125 ttaagcattatgaactaatataggttcgctcgattgataaggattaagttcaaatctcgtaaggataactgcaaactaaactttgatggttggatgagca 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42509731 ttaagcattatgaactaatataggttcgctcgattgataaggattaagttcaaatctcgtaaggataactgcaaactaaactttgatggttggatgagca 42509830  T
225 agtttgagatttaaaaacagataatattagtatgannnnnnncaaaataagatatccatttgaaattacctc 296  Q
    |||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||    
42509831 agtttgagatttaaaaacagataatattagtatgatttttttcaaaataagatatccatttgaaattacctc 42509902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 339 - 464
Target Start/End: Original strand, 42509945 - 42510070
Alignment:
339 ttattaatcagaactttcccttgatatgatttttcaggtacacgagattaaaatcaaataattttaatgattcaacaattataattaattgatagtgtaa 438  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42509945 ttattaatcagaactttcccttgatatgatttttcaggtacacgagattaaaatcaaataattttaatgattcaacaattataattaattgatagtgtaa 42510044  T
439 ataattctcgcaatatcatggcatgc 464  Q
    ||||||||||||||||||||||||||    
42510045 ataattctcgcaatatcatggcatgc 42510070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 384 - 433
Target Start/End: Complemental strand, 31765650 - 31765601
Alignment:
384 gattaaaatcaaataattttaatgattcaacaattataattaattgatag 433  Q
    ||||||||||||||| |||||||||| |||  ||||||||| ||||||||    
31765650 gattaaaatcaaatatttttaatgatccaagtattataattgattgatag 31765601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199518 times since January 2019
Visitors: 907