View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-8 (Length: 159)

Name: F9164J-LTR4-TNT-insertion-8
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-8
F9164J-LTR4-TNT-insertion-8
[»] chr1 (1 HSPs)
chr1 (9-149)||(9535762-9535902)
[»] chr4 (1 HSPs)
chr4 (43-87)||(19166691-19166735)


Alignment Details
Target: chr1 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 9 - 149
Target Start/End: Complemental strand, 9535902 - 9535762
Alignment:
9 aatcaacaatcaatacaaatacattaaaaatgcctaatgcttagaagattgtatttaagcccttcaacaagcataacattttttctgctagatgtggaag 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9535902 aatcaacaatcaatacaaatacattaaaaatgcctaatgcttagaagattgtatttaagcccttcaacaagcataacattttttctgctagatgtggaag 9535803  T
109 gatttccaacaacacctctactcagaattttacattgatta 149  Q
    |||||||||||||||||||||||||||||||||||||||||    
9535802 gatttccaacaacacctctactcagaattttacattgatta 9535762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 43 - 87
Target Start/End: Complemental strand, 19166735 - 19166691
Alignment:
43 taatgcttagaagattgtatttaagcccttcaacaagcataacat 87  Q
    ||||||||||| |||||| ||||||||||||||||||||||||||    
19166735 taatgcttagacgattgtgtttaagcccttcaacaagcataacat 19166691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 199751 times since January 2019
Visitors: 908