View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-9 (Length: 251)

Name: F9164J-LTR4-TNT-insertion-9
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9164J-LTR4-TNT-insertion-9
F9164J-LTR4-TNT-insertion-9
[»] chr8 (3 HSPs)
chr8 (8-241)||(31948860-31949093)
chr8 (74-241)||(31947325-31947492)
chr8 (8-65)||(31947216-31947273)


Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 241
Target Start/End: Original strand, 31948860 - 31949093
Alignment:
8 gttttgtaattgattgtagacactttaaaattttatcattgcataccttgtatcggttnnnnnnnntggttttaaagcttatgtttgcgaagggaaaaac 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||    
31948860 gttttgtaattgattgtagacactttaaaattttatcattgcataccttgtatcggttaaaaaaaatggttttaaagcttatgtttgcgaagggaaaaac 31948959  T
108 agagatatagtttgtcttctaaatgctacttctaccatatattaaacaacacagaaaatatattgcaaagatttcaacaatatttcatgcatgcatcgat 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31948960 agagatatagtttgtcttctaaatgctacttctaccatatattaaacaacacagaaaatatattgcaaagatttcaacaatatttcatgcatgcatcgat 31949059  T
208 cggttgctaaatttaaaatattcatcgattatta 241  Q
    ||||||||||||||||||||||||||||||||||    
31949060 cggttgctaaatttaaaatattcatcgattatta 31949093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 74 - 241
Target Start/End: Original strand, 31947325 - 31947492
Alignment:
74 tggttttaaagcttatgtttgcgaagggaaaaacagagatatagtttgtcttctaaatgctacttctaccatatattaaacaacacagaaaatatattgc 173  Q
    |||||||||||||||| |||||||||||||||| |||||||   |||||||||||||||||| ||| |||| |||||||| |||||||||||||||||||    
31947325 tggttttaaagcttatatttgcgaagggaaaaatagagatagtatttgtcttctaaatgctagttccaccacatattaaagaacacagaaaatatattgc 31947424  T
174 aaagatttcaacaatatttcatgcatgcatcgatcggttgctaaatttaaaatattcatcgattatta 241  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||    
31947425 aaagatttcaacaatatttcatgcatgcatcgatccgttgctaaatttaaaatatttatcgattatta 31947492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 31947216 - 31947273
Alignment:
8 gttttgtaattgattgtagacactttaaaattttatcattgcataccttgtatcggtt 65  Q
    |||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||    
31947216 gttttgtaattgattgtagacacttttaaattatatcattgcataccttgtaccggtt 31947273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 77675 times since January 2019
Visitors: 2276