View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9164J-LTR4-TNT-insertion-9 (Length: 251)

Name: F9164J-LTR4-TNT-insertion-9
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9164J-LTR4-TNT-insertion-9
[»] chr8 (3 HSPs)
chr8 (8-241)||(31948860-31949093)
chr8 (74-241)||(31947325-31947492)
chr8 (8-65)||(31947216-31947273)

Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 3)
Name: chr8

Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 241
Target Start/End: Original strand, 31948860 - 31949093
8 gttttgtaattgattgtagacactttaaaattttatcattgcataccttgtatcggttnnnnnnnntggttttaaagcttatgtttgcgaagggaaaaac 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||    
31948860 gttttgtaattgattgtagacactttaaaattttatcattgcataccttgtatcggttaaaaaaaatggttttaaagcttatgtttgcgaagggaaaaac 31948959  T
108 agagatatagtttgtcttctaaatgctacttctaccatatattaaacaacacagaaaatatattgcaaagatttcaacaatatttcatgcatgcatcgat 207  Q
31948960 agagatatagtttgtcttctaaatgctacttctaccatatattaaacaacacagaaaatatattgcaaagatttcaacaatatttcatgcatgcatcgat 31949059  T
208 cggttgctaaatttaaaatattcatcgattatta 241  Q
31949060 cggttgctaaatttaaaatattcatcgattatta 31949093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 74 - 241
Target Start/End: Original strand, 31947325 - 31947492
74 tggttttaaagcttatgtttgcgaagggaaaaacagagatatagtttgtcttctaaatgctacttctaccatatattaaacaacacagaaaatatattgc 173  Q
    |||||||||||||||| |||||||||||||||| |||||||   |||||||||||||||||| ||| |||| |||||||| |||||||||||||||||||    
31947325 tggttttaaagcttatatttgcgaagggaaaaatagagatagtatttgtcttctaaatgctagttccaccacatattaaagaacacagaaaatatattgc 31947424  T
174 aaagatttcaacaatatttcatgcatgcatcgatcggttgctaaatttaaaatattcatcgattatta 241  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||    
31947425 aaagatttcaacaatatttcatgcatgcatcgatccgttgctaaatttaaaatatttatcgattatta 31947492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 8 - 65
Target Start/End: Original strand, 31947216 - 31947273
8 gttttgtaattgattgtagacactttaaaattttatcattgcataccttgtatcggtt 65  Q
    |||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||    
31947216 gttttgtaattgattgtagacacttttaaattatatcattgcataccttgtaccggtt 31947273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 199798 times since January 2019
Visitors: 908