View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-1 (Length: 293)

Name: F9186J-LTR4-TNT-insertion-1
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9186J-LTR4-TNT-insertion-1
F9186J-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (5-283)||(36683614-36683892)
[»] chr3 (1 HSPs)
chr3 (232-269)||(24200485-24200522)


Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 5 - 283
Target Start/End: Complemental strand, 36683892 - 36683614
Alignment:
5 acattttcttgcgatcatataattagtcagtagttgtgagtgtttttgaatgtactttactataatatttattcattaaactataaaaatgaatcacaat 104  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36683892 acattttcttgcgatcatataattagtcagtagttgtgagtgtttttgaatgtactttactataatatttattcattaaactataaaaatgaatcacaat 36683793  T
105 ttattgttaagaaaacaatttgaatcgaaaaatatgttgtttgaatatttagaaaacaatttaaactgataaagacttcatctatatgttgatttagcac 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36683792 ttattgttaagaaaacaatttgaatcgaaaaatatgttgtttgaatatttagaaaacaatttaaactgataaagacttcatctatatgttgatttagcac 36683693  T
205 gttgatttggccaattgcaatcaattcttttttaatataatttatttatttagaaagctaaaaaagtaaatgacaatta 283  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36683692 gttgatttggccaattgcaatcaattcttttttaatataatttatttatttagaaagctaaaaaagtaaatgacaatta 36683614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 269
Target Start/End: Original strand, 24200485 - 24200522
Alignment:
232 ttttttaatataatttatttatttagaaagctaaaaaa 269  Q
    |||||||||| |||||||||||| ||||||||||||||    
24200485 ttttttaataaaatttatttattcagaaagctaaaaaa 24200522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC