View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-1 (Length: 293)

Name: F9186J-LTR4-TNT-insertion-1
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9186J-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (5-283)||(36683614-36683892)
[»] chr3 (1 HSPs)
chr3 (232-269)||(24200485-24200522)

Alignment Details
Target: chr5 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 5 - 283
Target Start/End: Complemental strand, 36683892 - 36683614
5 acattttcttgcgatcatataattagtcagtagttgtgagtgtttttgaatgtactttactataatatttattcattaaactataaaaatgaatcacaat 104  Q
36683892 acattttcttgcgatcatataattagtcagtagttgtgagtgtttttgaatgtactttactataatatttattcattaaactataaaaatgaatcacaat 36683793  T
105 ttattgttaagaaaacaatttgaatcgaaaaatatgttgtttgaatatttagaaaacaatttaaactgataaagacttcatctatatgttgatttagcac 204  Q
36683792 ttattgttaagaaaacaatttgaatcgaaaaatatgttgtttgaatatttagaaaacaatttaaactgataaagacttcatctatatgttgatttagcac 36683693  T
205 gttgatttggccaattgcaatcaattcttttttaatataatttatttatttagaaagctaaaaaagtaaatgacaatta 283  Q
36683692 gttgatttggccaattgcaatcaattcttttttaatataatttatttatttagaaagctaaaaaagtaaatgacaatta 36683614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 232 - 269
Target Start/End: Original strand, 24200485 - 24200522
232 ttttttaatataatttatttatttagaaagctaaaaaa 269  Q
    |||||||||| |||||||||||| ||||||||||||||    
24200485 ttttttaataaaatttatttattcagaaagctaaaaaa 24200522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 98511 times since January 2019
Visitors: 2275