View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-2 (Length: 227)

Name: F9186J-LTR4-TNT-insertion-2
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9186J-LTR4-TNT-insertion-2
F9186J-LTR4-TNT-insertion-2
[»] chr6 (1 HSPs)
chr6 (10-217)||(20830873-20831080)


Alignment Details
Target: chr6 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 10 - 217
Target Start/End: Original strand, 20830873 - 20831080
Alignment:
10 gatttccaacacatccattgttcaaattctcagtagaagacactctcaaatttagtgtccgacaatttcacaaatatcctttctacaatacattttacac 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20830873 gatttccaacacatccattgttcaaattctcagtagaagacactctcaaatttagtgtccgacaatttcacaaatatcctttctacaatacattttacac 20830972  T
110 attacaaatgaccctgtggaggggcaggtagggctaattgatatggcaagcaaaaccatattagatcttgatatacagccatgtttttgatagaaaatga 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20830973 attacaaatgaccctgtggaggggcaggtagggctaattgatatggcaagcaaaaccatattagatcttgatatacagccatgtttttgatagaaaatga 20831072  T
210 attcatta 217  Q
    ||| ||||    
20831073 attgatta 20831080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC