View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-4 (Length: 332)

Name: F9186J-LTR4-TNT-insertion-4
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9186J-LTR4-TNT-insertion-4
F9186J-LTR4-TNT-insertion-4
[»] chr8 (1 HSPs)
chr8 (7-322)||(11290731-11291046)


Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 7 - 322
Target Start/End: Complemental strand, 11291046 - 11290731
Alignment:
7 actaaacacgtataaaagcctaataaaaattgtcaaattaagttacaaactgtttttgcaaggtatttggctagcttgtatgaaggcttttgcttatttg 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11291046 actaaacacgtataaaagcctaataaaaattgtcaaattaagttacaaactgtttttgcaaggtatttggctagcttgtatgaaggcttttgcttatttg 11290947  T
107 ttgcggttgaaataaggatagaaataggaaggcagataatttaggttgatggccatactggtttatgcacaaatacagaaagcataggcataggtgattt 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11290946 ttgcggttgaaataaggatagaaataggaaggcagataatttaggttgatggccatactggtttatgcacaaatacagaaagcataggcataggtgattt 11290847  T
207 gagtttactaaaatagttgagccttaaggaagaggaggttgttgaagctgctcttgattcaagtcaagatttcatggtcattgctcatttnnnnnnntgc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||    
11290846 gagtttactaaaatagttgagccttaaggaagaggaggttgttgaagctgctcttgattcaagtcaagatttcatggtcattgctcatttaaaaaaatgc 11290747  T
307 tcaatttatctaatta 322  Q
    ||||||||||||||||    
11290746 tcaatttatctaatta 11290731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC