View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-4 (Length: 332)

Name: F9186J-LTR4-TNT-insertion-4
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9186J-LTR4-TNT-insertion-4
[»] chr8 (1 HSPs)
chr8 (7-322)||(11290731-11291046)

Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8

Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 7 - 322
Target Start/End: Complemental strand, 11291046 - 11290731
7 actaaacacgtataaaagcctaataaaaattgtcaaattaagttacaaactgtttttgcaaggtatttggctagcttgtatgaaggcttttgcttatttg 106  Q
11291046 actaaacacgtataaaagcctaataaaaattgtcaaattaagttacaaactgtttttgcaaggtatttggctagcttgtatgaaggcttttgcttatttg 11290947  T
107 ttgcggttgaaataaggatagaaataggaaggcagataatttaggttgatggccatactggtttatgcacaaatacagaaagcataggcataggtgattt 206  Q
11290946 ttgcggttgaaataaggatagaaataggaaggcagataatttaggttgatggccatactggtttatgcacaaatacagaaagcataggcataggtgattt 11290847  T
207 gagtttactaaaatagttgagccttaaggaagaggaggttgttgaagctgctcttgattcaagtcaagatttcatggtcattgctcatttnnnnnnntgc 306  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||    
11290846 gagtttactaaaatagttgagccttaaggaagaggaggttgttgaagctgctcttgattcaagtcaagatttcatggtcattgctcatttaaaaaaatgc 11290747  T
307 tcaatttatctaatta 322  Q
11290746 tcaatttatctaatta 11290731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 105497 times since January 2019
Visitors: 2328