View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-5 (Length: 269)

Name: F9186J-LTR4-TNT-insertion-5
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9186J-LTR4-TNT-insertion-5
F9186J-LTR4-TNT-insertion-5
[»] chr1 (5 HSPs)
chr1 (9-259)||(51779406-51779656)
chr1 (29-105)||(51803211-51803287)
chr1 (157-238)||(51771207-51771288)
chr1 (28-107)||(51807107-51807186)
chr1 (38-107)||(51771507-51771575)
[»] scaffold0710 (1 HSPs)
scaffold0710 (9-259)||(6048-6298)


Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 9 - 259
Target Start/End: Complemental strand, 51779656 - 51779406
Alignment:
9 caaccatcatcttatcttggttgaagaacttttatttaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaagaa 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51779656 caaccatcatcttatcttggttgaagaacttttatttaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaagaa 51779557  T
109 agatataattaagttaactttttcaaaagttttaaaggatgaaataattgtgaggatgcatcaacagagctttatgagtttgcattttaactttatgatg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51779556 agatataattaagttaactttttcaaaagttttaaaggatgaaataattgtgaggatgcatcaacagagctttatgagtttgcattttaactttatgatg 51779457  T
209 ctacacttatctaaattctgttgcagtaaggtaggtatatacaagtaatta 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
51779456 ctacacttatctaaattctgttgcagtaaggtaggtatatacaagtaatta 51779406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 29 - 105
Target Start/End: Complemental strand, 51803287 - 51803211
Alignment:
29 ttgaagaacttttatttaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaa 105  Q
    |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51803287 ttgaaggacttttattgaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaa 51803211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 157 - 238
Target Start/End: Complemental strand, 51771288 - 51771207
Alignment:
157 tgtgaggatgcatcaacagagctttatgagtttgcattttaactttatgatgctacacttatctaaattctgttgcagtaag 238  Q
    ||||||||||||||| |||||||||||||||| |||| |||||||| ||||||||||||| |||||||||| ||||||||||    
51771288 tgtgaggatgcatcagcagagctttatgagttggcatattaactttgtgatgctacacttgtctaaattctcttgcagtaag 51771207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 28 - 107
Target Start/End: Complemental strand, 51807186 - 51807107
Alignment:
28 gttgaagaacttttatttaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaaga 107  Q
    |||||||  |||||||| ||||||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||    
51807186 gttgaagttcttttattcaagataacattttgacatcatggactgtttggttgctttcagaaaaagatggtaaagaaaga 51807107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 38 - 107
Target Start/End: Complemental strand, 51771575 - 51771507
Alignment:
38 ttttatttaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaaga 107  Q
    ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
51771575 ttttattcaaaataat-ttttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaaga 51771507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0710 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: scaffold0710
Description:

Target: scaffold0710; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 9 - 259
Target Start/End: Complemental strand, 6298 - 6048
Alignment:
9 caaccatcatcttatcttggttgaagaacttttatttaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaagaa 108  Q
    |||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6298 caaccatcatcttatcttggttgaaggacttttattgaagataatattttgacatcatggattgtttggttgcttttagaaaaagatggtaaagaaagaa 6199  T
109 agatataattaagttaactttttcaaaagttttaaaggatgaaataattgtgaggatgcatcaacagagctttatgagtttgcattttaactttatgatg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6198 agatataattaagttaactttttcaaaagttttaaaggatgaaataattgtgaggatgcatcaacagagctttatgagtttgcattttaactttatgatg 6099  T
209 ctacacttatctaaattctgttgcagtaaggtaggtatatacaagtaatta 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
6098 ctacacttatctaaattctgttgcagtaaggtaggtatatacaagtaatta 6048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC