View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-6 (Length: 658)

Name: F9186J-LTR4-TNT-insertion-6
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9186J-LTR4-TNT-insertion-6
F9186J-LTR4-TNT-insertion-6
[»] chr6 (3 HSPs)
chr6 (7-649)||(22841669-22842311)
chr6 (29-140)||(15525594-15525705)
chr6 (554-649)||(15525485-15525580)
[»] chr7 (1 HSPs)
chr7 (7-649)||(14233175-14233817)
[»] chr3 (4 HSPs)
chr3 (7-379)||(15852165-15852537)
chr3 (175-350)||(20599648-20599820)
chr3 (492-640)||(15852667-15852815)
chr3 (219-345)||(4695602-4695728)
[»] chr2 (1 HSPs)
chr2 (7-642)||(37175060-37175716)
[»] scaffold0102 (1 HSPs)
scaffold0102 (219-340)||(3175-3296)
[»] chr4 (1 HSPs)
chr4 (266-340)||(31233553-31233627)
[»] chr1 (1 HSPs)
chr1 (219-345)||(23418726-23418852)


Alignment Details
Target: chr6 (Bit Score: 635; Significance: 0; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 635; E-Value: 0
Query Start/End: Original strand, 7 - 649
Target Start/End: Original strand, 22841669 - 22842311
Alignment:
7 atgaggaatatcaaggagcggcttctcaggttttacttatggatccaatgccaccaatcaatagggttttttcaatggttatgcaacaggaaaggaaaat 106  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22841669 atgaggaatatcaaggagtggcttctcaggttttacttatggatccaatgccaccaatcaatagggttttttcaatggttatgcaacaggaaaggaaaat 22841768  T
107 gcaatatggtgttatcaatgttcagaatacaccattagaggatactacaagtattgtaaatgcagtgaatggtcaaaaacagtttggcagaggtagagga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22841769 gcaatatggtgttatcaatgttcagaatacaccattagaggatactacaagtattgtaaatgcagtgaatggtcaaaaacagtttggcagaggtagagga 22841868  T
207 aatgggtcttctcaaggaagaggaagaggtaatggaagattttgtaccttttgtgaaaaaactaatcacacagtggaaacttgttacaagaagcatggat 306  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
22841869 aatgggtcttctcaaggaagaggaagaggtaatggaagattttgtaccttttgtgaaagaactaatcacacagtggaaacttgttacaagaagcatggat 22841968  T
307 accctccaaactggggaagaggtggaggaaattcctatgctaatatgattgatggagatgatgtagagagtaaaatgcagactgcatcaactagcaggaa 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22841969 accctccaaactggggaagaggtggaggaaattcctatgctaatatgattgatggagatgatgtagagagtaaaatgcagactgcatcaactagcaggaa 22842068  T
407 tgaagaaagtgcaggggtcactcttactaaggatcaatatcagaatctgatgtctctattggaaaagagtaaccttgagacaaagtgttcagcaaatgtt 506  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22842069 tgaagaaagtgcaggggtcactcttactaaggatcaatatcagaatctgatgtctctattggaaaagagtaaccttgagacaaagtgttcagcaaatgtt 22842168  T
507 gtgaaaggtatcaattactcttcatttattggaggtaattcatgttttgctaattttgatgataagcatgctgatactggatggattatagatacaggag 606  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22842169 gtgaaaggtatcaattactcttcatttattggaggtaattcatgttttgctaattttgatgataagcatgctgatactggatggattatagatacaggag 22842268  T
607 ctacacatcatacatgttttgatttgaaatggttcagtaattg 649  Q
    |||||||||||||||||||||||||||||||||||||||||||    
22842269 ctacacatcatacatgttttgatttgaaatggttcagtaattg 22842311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 29 - 140
Target Start/End: Complemental strand, 15525705 - 15525594
Alignment:
29 ttctcaggttttacttatggatccaatgccaccaatcaatagggttttttcaatggttatgcaacaggaaaggaaaatgcaatatggtgttatcaatgtt 128  Q
    |||||||||||| || |||||||||||||||||||| |||||||| ||||| |||||||| ||||| ||||||||| ||||||||||||| |||||||||    
15525705 ttctcaggttttgctgatggatccaatgccaccaataaatagggtattttctatggttatccaacaagaaaggaaactgcaatatggtgtgatcaatgtt 15525606  T
129 cagaatacacca 140  Q
    ||||||||||||    
15525605 cagaatacacca 15525594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 554 - 649
Target Start/End: Complemental strand, 15525580 - 15525485
Alignment:
554 tgctaattttgatgataagcatgctgatactggatggattatagatacaggagctacacatcatacatgttttgatttgaaatggttcagtaattg 649  Q
    ||||||||||||| | || |||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||||||||||| || ||||||||    
15525580 tgctaattttgataacaatcatgctgatactagatgtattatagatacaggagctacacatcatacttgttttgatttgaaatgttttagtaattg 15525485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 599; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 599; E-Value: 0
Query Start/End: Original strand, 7 - 649
Target Start/End: Original strand, 14233175 - 14233817
Alignment:
7 atgaggaatatcaaggagcggcttctcaggttttacttatggatccaatgccaccaatcaatagggttttttcaatggttatgcaacaggaaaggaaaat 106  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| |    
14233175 atgaggaatatcaaggagtggcttctcaggttttacttatggatccaatgccaccaatcaatagggtattttctatggttatgcaacaggaaaggaaact 14233274  T
107 gcaatatggtgttatcaatgttcagaatacaccattagaggatactacaagtattgtaaatgcagtgaatggtcaaaaacagtttggcagaggtagagga 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
14233275 gcaatatggtgttatcaatgttcagaatacaccattagaggatactgcaagtattgtaaatgcagtgaatggtcaaaaacagtttggcagaggtagagga 14233374  T
207 aatgggtcttctcaaggaagaggaagaggtaatggaagattttgtaccttttgtgaaaaaactaatcacacagtggaaacttgttacaagaagcatggat 306  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||    
14233375 aatgggttttctcaaggaagaggaagaggtaatggaagattttgtaccttttgtgaaagaactaatcacacagtggatacttgttacaagaagcatggat 14233474  T
307 accctccaaactggggaagaggtggaggaaattcctatgctaatatgattgatggagatgatgtagagagtaaaatgcagactgcatcaactagcaggaa 406  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14233475 accctccaaactggggaagaggtggaggaaattcctatgctaatatgattgatggagatgatgtagagagtaaaatgcagactgcatcaactagcaggaa 14233574  T
407 tgaagaaagtgcaggggtcactcttactaaggatcaatatcagaatctgatgtctctattggaaaagagtaaccttgagacaaagtgttcagcaaatgtt 506  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14233575 tgaagaaagtgcaggggtcactctcactaaggatcaatatcagaatctgatgtctctattggaaaagagtaaccttgagacaaagtgttcagcaaatgtt 14233674  T
507 gtgaaaggtatcaattactcttcatttattggaggtaattcatgttttgctaattttgatgataagcatgctgatactggatggattatagatacaggag 606  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
14233675 gtgaaaggtatcaattactcttcatttattggaggtaattcatgtttttctaattttgatgataagcatgctgatactggatggattatagatacaggag 14233774  T
607 ctacacatcatacatgttttgatttgaaatggttcagtaattg 649  Q
    ||||||||||||| |||||||||||||||||||||||||||||    
14233775 ctacacatcatacctgttttgatttgaaatggttcagtaattg 14233817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 89; Significance: 1e-42; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 7 - 379
Target Start/End: Original strand, 15852165 - 15852537
Alignment:
7 atgaggaatatcaaggagcggcttctcaggttttacttatggatccaatgccaccaatcaatagggttttttcaatggttatgcaacaggaaaggaaaat 106  Q
    |||| |||| |||||||| |||||||||||||||| | |||||||||||||||||||| ||||| || ||| || | ||||||||||| |||| ||   |    
15852165 atgaagaatgtcaaggagtggcttctcaggttttattgatggatccaatgccaccaattaatagagtatttccattagttatgcaacaagaaacgatgtt 15852264  T
107 gcaatatggtgttatcaatgttcagaatacaccattagaggatactacaagtattgtaaatgcagtgaatggtcaaaaacagtttggcagaggtagagga 206  Q
    ||| ||||||||  | ||||| || |||||||| || || || ||| || || | |||||||  |||||||| ||||| |||||||| |||||||||||     
15852265 gcagtatggtgtagttaatgtccaaaatacacctttggaagaaactgcatgtctggtaaatgttgtgaatggacaaaagcagtttggaagaggtagaggt 15852364  T
207 aatgggtcttctcaaggaagaggaagaggtaatggaagattttgtaccttttgtgaaaaaactaatcacacagtggaaacttgttacaagaagcatggat 306  Q
      |   |||| |||||||||||||||||| ||||| ||| ||||||| |||| ||||| | |    || |  ||||| | ||||||||||||||||||||    
15852365 ggtaattcttatcaaggaagaggaagaggaaatggtagagtttgtactttttttgaaagatcgggacatattgtggacagttgttacaagaagcatggat 15852464  T
307 accctccaaactggggaagaggtggaggaaattcctatgctaatatgattgatggagatgatgtagagagtaa 379  Q
    | || ||||||| ||| ||||| || |||||||  |||||||||||| | |||| |||||||  |||||||||    
15852465 atccaccaaactagggtagaggaggtggaaattattatgctaatatggtagatgcagatgatacagagagtaa 15852537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 175 - 350
Target Start/End: Original strand, 20599648 - 20599820
Alignment:
175 atggtcaaaaacagtttggcagaggtagaggaaatgggtcttctcaaggaagaggaagaggtaatggaagattttgtaccttttgtgaaaaaactaatca 274  Q
    ||||||| | ||| ||||| | |||||||||||||||   || |||||||||||||||||| |||   ||| | ||||  || ||| | | |||||||||    
20599648 atggtcagagacaatttggtataggtagaggaaatgg---ttttcaaggaagaggaagagggaatctcagagtgtgtagtttctgtaatagaactaatca 20599744  T
275 cacagtggaaacttgttacaagaagcatggataccctccaaactggggaagaggtggaggaaattcctatgctaat 350  Q
    ||| ||| |||||||||| ||||| ||||| |||||||| || ||||||||||| ||||||||||| | |||||||    
20599745 cactgtgaaaacttgttataagaaacatggttaccctcctaattggggaagaggaggaggaaattcttttgctaat 20599820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 492 - 640
Target Start/End: Original strand, 15852667 - 15852815
Alignment:
492 tgttcagcaaatgttgtgaaaggtatcaattactcttcatttattggaggtaattcatgttttgctaattttgatgataagcatgctgatactggatgga 591  Q
    |||||||||||||| ||||||||||  |||| || ||||   ||| |||||||||||| | | |||| |||||||  |||||||  ||||||||||||||    
15852667 tgttcagcaaatgtggtgaaaggtagaaattccttttcacacattagaggtaattcatatctggctagttttgatagtaagcataatgatactggatgga 15852766  T
592 ttatagatacaggagctacacatcatacatgttttgatttgaaatggtt 640  Q
    || |||| |||  ||  || |||||||| |||| ||||||||| |||||    
15852767 ttgtagacacaaaagaaactcatcatacttgttatgatttgaattggtt 15852815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 219 - 345
Target Start/End: Complemental strand, 4695728 - 4695602
Alignment:
219 caaggaagaggaagaggtaatggaagattttgtaccttttgtgaaaaaactaatcacacagtggaaacttgttacaagaagcatggataccctccaaact 318  Q
    ||||||||||||||||| ||||||||| ||||||  || |||| ||   | ||||||||  |||| |||||||| ||||||||||| |  ||||| || |    
4695728 caaggaagaggaagaggcaatggaagagtttgtaatttctgtggaaggtcaaatcacaccatggagacttgttataagaagcatggctttcctcctaatt 4695629  T
319 ggggaagaggtggaggaaattcctatg 345  Q
    |||| ||||| ||||||||||| ||||    
4695628 ggggtagaggaggaggaaattcttatg 4695602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 71; Significance: 8e-32; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 7 - 642
Target Start/End: Original strand, 37175060 - 37175716
Alignment:
7 atgaggaatatcaaggagcggcttctcaggttttacttatggatccaatgccaccaatcaatagggttttttcaatggttatgcaacaggaaaggaaaat 106  Q
    |||| |||||||||||||  || |||||||||||| | |||||||||||||||||||| ||||| || |||||  | ||||||||||| || |||||  |    
37175060 atgaagaatatcaaggagtagcctctcaggttttattgatggatccaatgccaccaattaatagagtattttctctagttatgcaacaagagaggaagtt 37175159  T
107 gcaatatggtgt--tatca-atgttcagaatacaccattagaggatactacaagtattgtaaatgcagtgaatggtcaaaaacagtttggcagaggtaga 203  Q
    ||| |||| |||  | ||  ||||||| |||||| | ||||| || | |||| || | || ||||| |||||||| || ||||| ||||| |||||||||    
37175160 gcagtatgctgtagtttctcatgttcaaaatacatctttagaagacaatacaggtctggtgaatgctgtgaatggccagaaacaatttggaagaggtaga 37175259  T
204 ggaaatgggtcttctcaaggaagaggaagagg------------------taatggaagattttgtaccttttgtgaaaaaactaatcacacagtggaaa 285  Q
    |||  |   |||| ||||||||||||||||||                  |||||| ||||| || || || ||||||| ||| ||||| || || ||||    
37175260 ggaggtacttcttatcaaggaagaggaagaggaaatggtagaggaaatggtaatggtagattctgcactttctgtgaaagaacaaatcatactgttgaaa 37175359  T
286 cttgttacaagaagcatggataccctccaaactggggaagaggtggaggaaattcctatgctaatatgattgatggagatgatgtagagagtaaaatgca 385  Q
    ||||||| || |||||||| || || ||||| ||||||||||| || |||||||| ||| | |||||| | |||| ||| |||   || ||||| ||  |    
37175360 cttgttataaaaagcatggttatccaccaaattggggaagaggaggtggaaattcttatacaaatatggtagatgcagaagatactgaaagtaagatcaa 37175459  T
386 gactgcatcaactagcaggaatgaagaaagtgcaggggtcactcttactaaggatcaatatcagaatctgatgtctctattggaaaagagtaaccttgag 485  Q
     |  | ||| || ||||| ||||| |||| ||||||  | |||||||| ||||| || ||||||||||| ||||| ||||||||||||| ||| |||||     
37175460 tatgggatctacaagcagaaatgatgaaaatgcaggcattactcttacaaaggaccagtatcagaatcttatgtcactattggaaaagaataatcttgaa 37175559  T
486 acaaagtgttcagcaaatgttgtgaaaggtatcaattactcttcatttattggaggtaattcatgttttgctaattttgatgataagcatgctgatactg 585  Q
    || ||||| ||||| ||||| |||||||||| ||| |    |||| |  ||| | |||| |||  | |||||| |||||||  ||||||   |||| |||    
37175560 actaagtgctcagctaatgtggtgaaaggtagcaactctatttcactctttgaaagtaaatcacttcttgctagttttgatagtaagcaaaatgatcctg 37175659  T
586 gatggattatagatacaggagctacacatcatacatgttttgatttgaaatggttca 642  Q
    |||||||  ||||||||||||| || ||||| || |||| ||||||||| |||||||    
37175660 gatggatagtagatacaggagcaactcatcacacttgttatgatttgaactggttca 37175716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0102 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0102
Description:

Target: scaffold0102; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 219 - 340
Target Start/End: Original strand, 3175 - 3296
Alignment:
219 caaggaagaggaagaggtaatggaagattttgtaccttttgtgaaaaaactaatcacacagtggaaacttgttacaagaagcatggataccctccaaact 318  Q
    ||||||||||||||||| ||||||||| ||||||  || |||| ||   | ||||||||  |||| |||||||| ||||||||||| |  ||||| || |    
3175 caaggaagaggaagaggcaatggaagagtttgtaatttctgtggaaggtcaaatcacaccatggagacttgttataagaagcatggctttcctcctaatt 3274  T
319 ggggaagaggtggaggaaattc 340  Q
    |||| ||||| ||||| |||||    
3275 ggggtagaggaggaggtaattc 3296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 266 - 340
Target Start/End: Complemental strand, 31233627 - 31233553
Alignment:
266 aactaatcacacagtggaaacttgttacaagaagcatggataccctccaaactggggaagaggtggaggaaattc 340  Q
    ||||||||||||||| ||||| ||||||||||| ||||| || | ||| || ||||| ||||| || ||||||||    
31233627 aactaatcacacagttgaaacatgttacaagaaacatggttagcttcctaattggggcagaggaggtggaaattc 31233553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 219 - 345
Target Start/End: Complemental strand, 23418852 - 23418726
Alignment:
219 caaggaagaggaagaggtaatggaagattttgtaccttttgtgaaaaaactaatcacacagtggaaacttgttacaagaagcatggataccctccaaact 318  Q
    ||||||||||||||||| || |||||| ||||||  || |||| ||   | ||||||||  |||| |||||||| ||||||||||| |  ||||| || |    
23418852 caaggaagaggaagaggcaacggaagagtttgtaatttctgtggaaggtcaaatcacaccatggagacttgttataagaagcatggctttcctcctaatt 23418753  T
319 ggggaagaggtggaggaaattcctatg 345  Q
    |||| ||||| ||||| ||||| ||||    
23418752 ggggtagaggaggaggtaattcttatg 23418726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98561 times since January 2019
Visitors: 2275