View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-7 (Length: 380)

Name: F9186J-LTR4-TNT-insertion-7
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9186J-LTR4-TNT-insertion-7
F9186J-LTR4-TNT-insertion-7
[»] chr3 (11 HSPs)
chr3 (8-370)||(47921667-47922029)
chr3 (8-200)||(47913693-47913903)
chr3 (112-216)||(47931255-47931359)
chr3 (270-362)||(47948802-47948894)
chr3 (116-195)||(47942517-47942596)
chr3 (277-363)||(47930748-47930834)
chr3 (268-349)||(47942196-47942277)
chr3 (31-84)||(47949320-47949373)
chr3 (117-185)||(47949195-47949263)
chr3 (263-363)||(47913435-47913535)
chr3 (31-84)||(47942646-47942699)
[»] chr6 (1 HSPs)
chr6 (268-365)||(3858883-3858980)


Alignment Details
Target: chr3 (Bit Score: 363; Significance: 0; HSPs: 11)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 8 - 370
Target Start/End: Complemental strand, 47922029 - 47921667
Alignment:
8 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttgcaccataatgcaagaac 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47922029 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttgcaccataatgcaagaac 47921930  T
108 atattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcataactcctccatcc 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47921929 atattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcataactcctccatcc 47921830  T
208 caattataattacttaagtattttatatcagtgtttgatacaaaatttgtgattatttattgcagagtcaagatggagatattattgactgcgtcaacat 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47921829 caattataattacttaagtattttatatcagtgtttgatacaaaatttgtgattatttattgcagagtcaagatggagatattattgactgcgtcaacat 47921730  T
308 ctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgcataatta 370  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47921729 ctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgcataatta 47921667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 47913903 - 47913693
Alignment:
8 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttg--caccata-------- 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||            
47913903 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttgtgcaccatactagaatt 47913804  T
98 --------atgcaagaacatattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaat 189  Q
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
47913803 gaaagttgatgcaagaacatattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatccatcagggtatgcaat 47913704  T
190 ttcataactcc 200  Q
    | |||||||||    
47913703 tccataactcc 47913693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 112 - 216
Target Start/End: Complemental strand, 47931359 - 47931255
Alignment:
112 tcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcataactcctccatcccaat 211  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||| ||     
47931359 tcacctttagaaagagaaatagaagccaaattgaagctcttaaacaagcctgcagtgaaatccatcagggtatgcaatttcataaatcccccatcctaaa 47931260  T
212 tataa 216  Q
    |||||    
47931259 tataa 47931255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 270 - 362
Target Start/End: Complemental strand, 47948894 - 47948802
Alignment:
270 cagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtg 362  Q
    |||||| ||||||||||||||||||||||| ||||||| ||| ||||||| |||||||| ||||||||||| | |||||| | ||||||||||    
47948894 cagagtgaagatggagatattattgactgcatcaacatatacaaacaacccgcttttgaccatcctgccttgataaatcacactattcaggtg 47948802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 116 - 195
Target Start/End: Complemental strand, 47942596 - 47942517
Alignment:
116 ctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcata 195  Q
    |||||||||||||||| |||||||||||||| ||  |||||||||||||||||||||| |||| ||||||||||| ||||    
47942596 ctttagaaagagaaattgaagccaaattgaaacttctaaacaagcctgcagtgaaatccatcaaggtatgcaattccata 47942517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 277 - 363
Target Start/End: Complemental strand, 47930834 - 47930748
Alignment:
277 aagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgc 363  Q
    |||||||||| |||||||| || || ||||||||  ||||||  ||||| ||||||||||| ||||||||||| | |||||||||||    
47930834 aagatggagacattattgattgtgttaacatctataaacaacttgctttagatcatcctgctttaaaaaatcacattattcaggtgc 47930748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 268 - 349
Target Start/End: Complemental strand, 47942277 - 47942196
Alignment:
268 tgcagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatca 349  Q
    |||||||| ||||||| || |||||||| || ||| | || ||| ||||||| |||||||| ||||||||||||||||||||    
47942277 tgcagagtgaagatggtgacattattgattgtgtcgatatttacaaacaacccgcttttgaccatcctgccttaaaaaatca 47942196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 47949373 - 47949320
Alignment:
31 caagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttcttt 84  Q
    |||| |||||||||||||| ||||||| |||||||||||||||| |||||||||    
47949373 caaggtggaatggggaaatgcaaggttgcaatattgttgctttgggtgttcttt 47949320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 117 - 185
Target Start/End: Complemental strand, 47949263 - 47949195
Alignment:
117 tttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatg 185  Q
    |||||||| |||||||||||||||||| |||||  ||||||||||||| ||||| || |||| ||||||    
47949263 tttagaaaaagaaatcgaagccaaattaaagcttctaaacaagcctgccgtgaagtctatcaaggtatg 47949195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 363
Target Start/End: Complemental strand, 47913535 - 47913435
Alignment:
263 tttattgcagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtg 362  Q
    ||||||||||||  |||||||||| |||||||| || || | ||||||  | |||||   ||| ||||||||||||||||| ||||| ||||||| ||||    
47913535 tttattgcagagcgaagatggagacattattgattgtgttagcatctataatcaacctagtttagatcatcctgccttaaagaatcacagtattcgggtg 47913436  T
363 c 363  Q
    |    
47913435 c 47913435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 47942699 - 47942646
Alignment:
31 caagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttcttt 84  Q
    |||| |||||||||||||| ||||||| | ||||||||||||||  ||||||||    
47942699 caaggtggaatggggaaatgcaaggttgccatattgttgctttggatgttcttt 47942646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 268 - 365
Target Start/End: Original strand, 3858883 - 3858980
Alignment:
268 tgcagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgcat 365  Q
    |||||||| || |||||||||||||||| |||||| |||| ||  ||||||| |||||||| ||||||| ||||||||| || |  ||||||||||||    
3858883 tgcagagtgaaaatggagatattattgattgcgtcgacatttataaacaacctgcttttgaccatcctgtcttaaaaaaccacacaattcaggtgcat 3858980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC