View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9186J-LTR4-TNT-insertion-7 (Length: 380)

Name: F9186J-LTR4-TNT-insertion-7
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9186J-LTR4-TNT-insertion-7
[»] chr3 (11 HSPs)
chr3 (8-370)||(47921667-47922029)
chr3 (8-200)||(47913693-47913903)
chr3 (112-216)||(47931255-47931359)
chr3 (270-362)||(47948802-47948894)
chr3 (116-195)||(47942517-47942596)
chr3 (277-363)||(47930748-47930834)
chr3 (268-349)||(47942196-47942277)
chr3 (31-84)||(47949320-47949373)
chr3 (117-185)||(47949195-47949263)
chr3 (263-363)||(47913435-47913535)
chr3 (31-84)||(47942646-47942699)
[»] chr6 (1 HSPs)
chr6 (268-365)||(3858883-3858980)

Alignment Details
Target: chr3 (Bit Score: 363; Significance: 0; HSPs: 11)
Name: chr3

Target: chr3; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 8 - 370
Target Start/End: Complemental strand, 47922029 - 47921667
8 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttgcaccataatgcaagaac 107  Q
47922029 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttgcaccataatgcaagaac 47921930  T
108 atattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcataactcctccatcc 207  Q
47921929 atattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcataactcctccatcc 47921830  T
208 caattataattacttaagtattttatatcagtgtttgatacaaaatttgtgattatttattgcagagtcaagatggagatattattgactgcgtcaacat 307  Q
47921829 caattataattacttaagtattttatatcagtgtttgatacaaaatttgtgattatttattgcagagtcaagatggagatattattgactgcgtcaacat 47921730  T
308 ctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgcataatta 370  Q
47921729 ctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgcataatta 47921667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 139; E-Value: 1e-72
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 47913903 - 47913693
8 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttg--caccata-------- 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||            
47913903 aaaagaagagatcaagatatcaacaagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttctttaacttgtgcaccatactagaatt 47913804  T
98 --------atgcaagaacatattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaat 189  Q
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
47913803 gaaagttgatgcaagaacatattcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatccatcagggtatgcaat 47913704  T
190 ttcataactcc 200  Q
    | |||||||||    
47913703 tccataactcc 47913693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 112 - 216
Target Start/End: Complemental strand, 47931359 - 47931255
112 tcacctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcataactcctccatcccaat 211  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||| ||     
47931359 tcacctttagaaagagaaatagaagccaaattgaagctcttaaacaagcctgcagtgaaatccatcagggtatgcaatttcataaatcccccatcctaaa 47931260  T
212 tataa 216  Q
47931259 tataa 47931255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 270 - 362
Target Start/End: Complemental strand, 47948894 - 47948802
270 cagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtg 362  Q
    |||||| ||||||||||||||||||||||| ||||||| ||| ||||||| |||||||| ||||||||||| | |||||| | ||||||||||    
47948894 cagagtgaagatggagatattattgactgcatcaacatatacaaacaacccgcttttgaccatcctgccttgataaatcacactattcaggtg 47948802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 116 - 195
Target Start/End: Complemental strand, 47942596 - 47942517
116 ctttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatgcaatttcata 195  Q
    |||||||||||||||| |||||||||||||| ||  |||||||||||||||||||||| |||| ||||||||||| ||||    
47942596 ctttagaaagagaaattgaagccaaattgaaacttctaaacaagcctgcagtgaaatccatcaaggtatgcaattccata 47942517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 277 - 363
Target Start/End: Complemental strand, 47930834 - 47930748
277 aagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgc 363  Q
    |||||||||| |||||||| || || ||||||||  ||||||  ||||| ||||||||||| ||||||||||| | |||||||||||    
47930834 aagatggagacattattgattgtgttaacatctataaacaacttgctttagatcatcctgctttaaaaaatcacattattcaggtgc 47930748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 268 - 349
Target Start/End: Complemental strand, 47942277 - 47942196
268 tgcagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatca 349  Q
    |||||||| ||||||| || |||||||| || ||| | || ||| ||||||| |||||||| ||||||||||||||||||||    
47942277 tgcagagtgaagatggtgacattattgattgtgtcgatatttacaaacaacccgcttttgaccatcctgccttaaaaaatca 47942196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 47949373 - 47949320
31 caagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttcttt 84  Q
    |||| |||||||||||||| ||||||| |||||||||||||||| |||||||||    
47949373 caaggtggaatggggaaatgcaaggttgcaatattgttgctttgggtgttcttt 47949320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 117 - 185
Target Start/End: Complemental strand, 47949263 - 47949195
117 tttagaaagagaaatcgaagccaaattgaagctcttaaacaagcctgcagtgaaatcaatcagggtatg 185  Q
    |||||||| |||||||||||||||||| |||||  ||||||||||||| ||||| || |||| ||||||    
47949263 tttagaaaaagaaatcgaagccaaattaaagcttctaaacaagcctgccgtgaagtctatcaaggtatg 47949195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 263 - 363
Target Start/End: Complemental strand, 47913535 - 47913435
263 tttattgcagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtg 362  Q
    ||||||||||||  |||||||||| |||||||| || || | ||||||  | |||||   ||| ||||||||||||||||| ||||| ||||||| ||||    
47913535 tttattgcagagcgaagatggagacattattgattgtgttagcatctataatcaacctagtttagatcatcctgccttaaagaatcacagtattcgggtg 47913436  T
363 c 363  Q
47913435 c 47913435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 31 - 84
Target Start/End: Complemental strand, 47942699 - 47942646
31 caagttggaatggggaaatacaaggttccaatattgttgctttgtgtgttcttt 84  Q
    |||| |||||||||||||| ||||||| | ||||||||||||||  ||||||||    
47942699 caaggtggaatggggaaatgcaaggttgccatattgttgctttggatgttcttt 47942646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 1)
Name: chr6

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 268 - 365
Target Start/End: Original strand, 3858883 - 3858980
268 tgcagagtcaagatggagatattattgactgcgtcaacatctacgaacaaccggcttttgatcatcctgccttaaaaaatcatagtattcaggtgcat 365  Q
    |||||||| || |||||||||||||||| |||||| |||| ||  ||||||| |||||||| ||||||| ||||||||| || |  ||||||||||||    
3858883 tgcagagtgaaaatggagatattattgattgcgtcgacatttataaacaacctgcttttgaccatcctgtcttaaaaaaccacacaattcaggtgcat 3858980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 77951 times since January 2019
Visitors: 2276