View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-1 (Length: 508)

Name: F9276-LTR4-TNT-insertion-1
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9276-LTR4-TNT-insertion-1
F9276-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (8-499)||(35676743-35677234)


Alignment Details
Target: chr5 (Bit Score: 492; Significance: 0; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 492; E-Value: 0
Query Start/End: Original strand, 8 - 499
Target Start/End: Original strand, 35676743 - 35677234
Alignment:
8 caaagaaacctctctagagcctactcataactcttcaaattttagaggaccaaatcaaggtttcccgagtcctacagatcagagaagaatatttccaaga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35676743 caaagaaacctctctagagcctactcataactcttcaaattttagaggaccaaatcaaggtttcccgagtcctacagatcagagaagaatatttccaaga 35676842  T
108 caaatggagacaatgcttaaacagactactttctacatgactatagataatgatcataaataaccagcccaacaaaactcaagttcaactatcaacaaac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35676843 caaatggagacaatgcttaaacagactactttctacatgactatagataatgatcataaataaccagcccaacaaaactcaagttcaactatcaacaaac 35676942  T
208 ctacgaaacaaaaattaggaaaagcaaaatgcttacaatagacaagttggaatacctcctggaagataacatgaaaatcacatgtaatggcaaattcacc 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35676943 ctacgaaacaaaaattaggaaaagcaaaatgcttacaatagacaagttggaatacctcctggaagataacatgaaaatcacatgtaatggcaaattcacc 35677042  T
308 ccatatccaacaaaaacggtcggcctgttcaacaagccaaccgatataattattcgttttgttgatttacaactttcttgaatcaattaacaaagagtat 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35677043 ccatatccaacaaaaacggtcggcctgttcaacaagccaaccgatataattattcgttttgttgatttacaactttcttgaatcaattaacaaagagtat 35677142  T
408 cttttgataaacataccgaacatttgtgaatgcatgctttattaattacagaaaatattaagtagtagtattagataaatcacacacaattg 499  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35677143 cttttgataaacataccgaacatttgtgaatgcatgctttattaattacagaaaatattaagtagtagtattagataaatcacacacaattg 35677234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98202 times since January 2019
Visitors: 2269