View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-1 (Length: 508)

Name: F9276-LTR4-TNT-insertion-1
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9276-LTR4-TNT-insertion-1
[»] chr5 (1 HSPs)
chr5 (8-499)||(35676743-35677234)

Alignment Details
Target: chr5 (Bit Score: 492; Significance: 0; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 492; E-Value: 0
Query Start/End: Original strand, 8 - 499
Target Start/End: Original strand, 35676743 - 35677234
8 caaagaaacctctctagagcctactcataactcttcaaattttagaggaccaaatcaaggtttcccgagtcctacagatcagagaagaatatttccaaga 107  Q
35676743 caaagaaacctctctagagcctactcataactcttcaaattttagaggaccaaatcaaggtttcccgagtcctacagatcagagaagaatatttccaaga 35676842  T
108 caaatggagacaatgcttaaacagactactttctacatgactatagataatgatcataaataaccagcccaacaaaactcaagttcaactatcaacaaac 207  Q
35676843 caaatggagacaatgcttaaacagactactttctacatgactatagataatgatcataaataaccagcccaacaaaactcaagttcaactatcaacaaac 35676942  T
208 ctacgaaacaaaaattaggaaaagcaaaatgcttacaatagacaagttggaatacctcctggaagataacatgaaaatcacatgtaatggcaaattcacc 307  Q
35676943 ctacgaaacaaaaattaggaaaagcaaaatgcttacaatagacaagttggaatacctcctggaagataacatgaaaatcacatgtaatggcaaattcacc 35677042  T
308 ccatatccaacaaaaacggtcggcctgttcaacaagccaaccgatataattattcgttttgttgatttacaactttcttgaatcaattaacaaagagtat 407  Q
35677043 ccatatccaacaaaaacggtcggcctgttcaacaagccaaccgatataattattcgttttgttgatttacaactttcttgaatcaattaacaaagagtat 35677142  T
408 cttttgataaacataccgaacatttgtgaatgcatgctttattaattacagaaaatattaagtagtagtattagataaatcacacacaattg 499  Q
35677143 cttttgataaacataccgaacatttgtgaatgcatgctttattaattacagaaaatattaagtagtagtattagataaatcacacacaattg 35677234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC