View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-2 (Length: 451)

Name: F9276-LTR4-TNT-insertion-2
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9276-LTR4-TNT-insertion-2
F9276-LTR4-TNT-insertion-2
[»] chr3 (2 HSPs)
chr3 (9-441)||(24750314-24750746)
chr3 (96-269)||(31330464-31330637)
[»] chr5 (1 HSPs)
chr5 (114-266)||(35016286-35016438)
[»] chr4 (1 HSPs)
chr4 (118-266)||(5779699-5779847)


Alignment Details
Target: chr3 (Bit Score: 433; Significance: 0; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 433; E-Value: 0
Query Start/End: Original strand, 9 - 441
Target Start/End: Original strand, 24750314 - 24750746
Alignment:
9 gtggtgccattgcaaacagtgagatcaagggtacaatttgtgaagatatcatcacttggacttatattttgtttgtctgtggttggagggaatatttctc 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24750314 gtggtgccattgcaaacagtgagatcaagggtacaatttgtgaagatatcatcacttggacttatattttgtttgtctgtggttggagggaatatttctc 24750413  T
109 taagatatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24750414 taagatatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttg 24750513  T
209 gcttacttatatggctcttgtacctgttgttactggtgttatgattgctagtggggtatgtcctctttcttatctcttgtcttttatctcttgtattatg 308  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24750514 gcttacttatatggctcttgtacctgttgttactggtgttatgattgctagtggggtatgtcctctttcttatctcttgtcttttatctcttgtattatg 24750613  T
309 gtagcaatttaaagagtttttgtttaagtgatttgggtttttggagattcgttagggtcatggaaaacctcaacggtcaatgcgtcaccagaaatacata 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24750614 gtagcaatttaaagagtttttgtttaagtgatttgggtttttggagattcgttagggtcatggaaaacctcaacggtcaatgcgtcaccagaaatacata 24750713  T
409 tagattatccaccaagccaacaaacttcaatta 441  Q
    |||||||||||||||||||||||||||||||||    
24750714 tagattatccaccaagccaacaaacttcaatta 24750746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 96 - 269
Target Start/End: Original strand, 31330464 - 31330637
Alignment:
96 gggaatatttctctaagatatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgaccctta 195  Q
    ||||||||||| ||  |||||||||||||||| |||||||| |||||||| || || || || || ||||| ||  ||||||||||| |||||||| |||    
31330464 gggaatatttcgcttcgatatcttcctgtgtcgtttaatcaggctattggcgcgactacgcctttctttactgccatttttgcttatattatgaccttta 31330563  T
196 agagggagggttggcttacttatatggctcttgtacctgttgttactggtgttatgattgctagtggggtatgt 269  Q
    ||||||||| ||| || |||||| |  | ||||| |||||||||||||||||| | ||||||||||||||||||    
31330564 agagggaggcttgtctcacttatcttacccttgttcctgttgttactggtgttgttattgctagtggggtatgt 31330637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 89; Significance: 1e-42; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 114 - 266
Target Start/End: Original strand, 35016286 - 35016438
Alignment:
114 tatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttggctta 213  Q
    |||||||||||||| |||||||||||||| |||||||| || ||||||||||| |||||||||||||||  |||||| || || || |||| ||||||||    
35016286 tatcttcctgtgtcgtttaatcaagctatcggtgctactacgccgttttttactgcggtttttgcttatgctatgacgctcaaaagagaggcttggctta 35016385  T
214 cttatatggctcttgtacctgttgttactggtgttatgattgctagtggggta 266  Q
    ||||| | |||||||| |||||||||||||||||||| |||||||||||||||    
35016386 cttatcttgctcttgttcctgttgttactggtgttatcattgctagtggggta 35016438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 118 - 266
Target Start/End: Complemental strand, 5779847 - 5779699
Alignment:
118 ttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttggcttactta 217  Q
    |||| ||||| ||||||||||||||||||||||| ||||| ||||| || || |||||||||||| || |||     || || |||| |||| |||||||    
5779847 ttccggtgtcgtttaatcaagctattggtgctactacaccttttttcaccgctgtttttgcttatgttgtgagtagaaaaagagaggcttgggttactta 5779748  T
218 tatggctcttgtacctgttgttactggtgttatgattgctagtggggta 266  Q
    |    ||||| | ||||||||| |||||||| | |||||||||||||||    
5779747 tgctactcttttgcctgttgttgctggtgttgtcattgctagtggggta 5779699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105613 times since January 2019
Visitors: 2328