View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-2 (Length: 451)

Name: F9276-LTR4-TNT-insertion-2
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9276-LTR4-TNT-insertion-2
[»] chr3 (2 HSPs)
chr3 (9-441)||(24750314-24750746)
chr3 (96-269)||(31330464-31330637)
[»] chr5 (1 HSPs)
chr5 (114-266)||(35016286-35016438)
[»] chr4 (1 HSPs)
chr4 (118-266)||(5779699-5779847)

Alignment Details
Target: chr3 (Bit Score: 433; Significance: 0; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 433; E-Value: 0
Query Start/End: Original strand, 9 - 441
Target Start/End: Original strand, 24750314 - 24750746
9 gtggtgccattgcaaacagtgagatcaagggtacaatttgtgaagatatcatcacttggacttatattttgtttgtctgtggttggagggaatatttctc 108  Q
24750314 gtggtgccattgcaaacagtgagatcaagggtacaatttgtgaagatatcatcacttggacttatattttgtttgtctgtggttggagggaatatttctc 24750413  T
109 taagatatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttg 208  Q
24750414 taagatatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttg 24750513  T
209 gcttacttatatggctcttgtacctgttgttactggtgttatgattgctagtggggtatgtcctctttcttatctcttgtcttttatctcttgtattatg 308  Q
24750514 gcttacttatatggctcttgtacctgttgttactggtgttatgattgctagtggggtatgtcctctttcttatctcttgtcttttatctcttgtattatg 24750613  T
309 gtagcaatttaaagagtttttgtttaagtgatttgggtttttggagattcgttagggtcatggaaaacctcaacggtcaatgcgtcaccagaaatacata 408  Q
24750614 gtagcaatttaaagagtttttgtttaagtgatttgggtttttggagattcgttagggtcatggaaaacctcaacggtcaatgcgtcaccagaaatacata 24750713  T
409 tagattatccaccaagccaacaaacttcaatta 441  Q
24750714 tagattatccaccaagccaacaaacttcaatta 24750746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 96 - 269
Target Start/End: Original strand, 31330464 - 31330637
96 gggaatatttctctaagatatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgaccctta 195  Q
    ||||||||||| ||  |||||||||||||||| |||||||| |||||||| || || || || || ||||| ||  ||||||||||| |||||||| |||    
31330464 gggaatatttcgcttcgatatcttcctgtgtcgtttaatcaggctattggcgcgactacgcctttctttactgccatttttgcttatattatgaccttta 31330563  T
196 agagggagggttggcttacttatatggctcttgtacctgttgttactggtgttatgattgctagtggggtatgt 269  Q
    ||||||||| ||| || |||||| |  | ||||| |||||||||||||||||| | ||||||||||||||||||    
31330564 agagggaggcttgtctcacttatcttacccttgttcctgttgttactggtgttgttattgctagtggggtatgt 31330637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 89; Significance: 1e-42; HSPs: 1)
Name: chr5

Target: chr5; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 114 - 266
Target Start/End: Original strand, 35016286 - 35016438
114 tatcttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttggctta 213  Q
    |||||||||||||| |||||||||||||| |||||||| || ||||||||||| |||||||||||||||  |||||| || || || |||| ||||||||    
35016286 tatcttcctgtgtcgtttaatcaagctatcggtgctactacgccgttttttactgcggtttttgcttatgctatgacgctcaaaagagaggcttggctta 35016385  T
214 cttatatggctcttgtacctgttgttactggtgttatgattgctagtggggta 266  Q
    ||||| | |||||||| |||||||||||||||||||| |||||||||||||||    
35016386 cttatcttgctcttgttcctgttgttactggtgttatcattgctagtggggta 35016438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr4

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 118 - 266
Target Start/End: Complemental strand, 5779847 - 5779699
118 ttcctgtgtcttttaatcaagctattggtgctacgacaccgttttttacggcggtttttgcttatcttatgacccttaagagggagggttggcttactta 217  Q
    |||| ||||| ||||||||||||||||||||||| ||||| ||||| || || |||||||||||| || |||     || || |||| |||| |||||||    
5779847 ttccggtgtcgtttaatcaagctattggtgctactacaccttttttcaccgctgtttttgcttatgttgtgagtagaaaaagagaggcttgggttactta 5779748  T
218 tatggctcttgtacctgttgttactggtgttatgattgctagtggggta 266  Q
    |    ||||| | ||||||||| |||||||| | |||||||||||||||    
5779747 tgctactcttttgcctgttgttgctggtgttgtcattgctagtggggta 5779699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC