View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-5 (Length: 490)

Name: F9276-LTR4-TNT-insertion-5
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9276-LTR4-TNT-insertion-5
F9276-LTR4-TNT-insertion-5
[»] chr4 (4 HSPs)
chr4 (10-480)||(42741506-42741976)
chr4 (12-401)||(42760404-42760795)
chr4 (10-401)||(42750940-42751335)
chr4 (14-243)||(42736719-42736947)
[»] chr5 (1 HSPs)
chr5 (10-401)||(23042523-23042916)


Alignment Details
Target: chr4 (Bit Score: 471; Significance: 0; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 471; E-Value: 0
Query Start/End: Original strand, 10 - 480
Target Start/End: Complemental strand, 42741976 - 42741506
Alignment:
10 catatccaagcacccgtagaatttctagtttcagtgaaccctaggagactaaatttcaagaaaaagggtgaaaaaagagagttcaaggttacattaacct 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42741976 catatccaagcacccgtagaatttctagtttcagtgaaccctaggagactaaatttcaagaaaaagggtgaaaaaagagagttcaaggttacattaacct 42741877  T
110 tgaagaaaggaactacgtataagactgattacgtctttggaaaattggtttggaccgatgggaaacatcaagttgggattcctatttcaataaagtatcc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42741876 tgaagaaaggaactacgtataagactgattacgtctttggaaaattggtttggaccgatgggaaacatcaagttgggattcctatttcaataaagtatcc 42741777  T
210 acattagtgagatttaggttgttgttgcattttgctaccacctgtttaaagtggtgtctcactttttctccctggtttcaataacaagacatgttgtatt 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42741776 acattagtgagatttaggttgttgttgcattttgctaccacctgtttaaagtggtgtctcactttttctccctggtttcaataacaagacatgttgtatt 42741677  T
310 atgtacaagttcttcaaaggttgtgaagtgaatatatcaatgttgttttaatggtaatttatggtgagtgaaatcaaatgaataagataaaatagtatga 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42741676 atgtacaagttcttcaaaggttgtgaagtgaatatatcaatgttgttttaatggtaatttatggtgagtgaaatcaaatgaataagataaaatagtatga 42741577  T
410 tgagtcgttatgtttcatgattaaaaataatatttagatacctacatacaatatattcctataacatatta 480  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42741576 tgagtcgttatgtttcatgattaaaaataatatttagatacctacatacaatatattcctataacatatta 42741506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 12 - 401
Target Start/End: Complemental strand, 42760795 - 42760404
Alignment:
12 tatccaagcacccgtagaatttctagtttcagtgaaccctaggagactaaatttcaagaaaaagggtgaaaaaagagagttcaaggttacattaaccttg 111  Q
    |||||||||||||| |||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
42760795 tatccaagcacccgcagaacttctagtttcagtgaaccctaggagactaaacttcaagaaaaagggtgaaaaaagagagttcaaggttacattaaccttg 42760696  T
112 aagaaaggaactacgtataagactgattacgtctttggaaaattggtttggaccgatgggaaacatcaagttgggattcctatttcaataaagtatccac 211  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||| ||||||| |||||||||||||||    
42760695 aagaaaggaactacgtataagactgattacgtctttggaaaattggtttggaacgatggaaaacatcaagttgggactcctattgcaataaagtatccac 42760596  T
212 attagtg----agatttaggttgttgttgcattttgctaccacctgtttaaagtggtgtctcactttttctccctggtttcaataacaagacatgttgta 307  Q
    |||||||      |||||||||  || |||||||| |||| |  |||||||    |||||    |||||||||| | |||||||||   ||||||||||     
42760595 attagtggtatttatttaggttactgctgcatttt-ctacaaattgtttaagacagtgtcaatatttttctccc-gttttcaataaagggacatgttgtg 42760498  T
308 ttatgtacaagttcttcaaaggttgtgaagtgaatatatcaatgttgttttaatggtaatttatggtgagtgaaatcaaatgaataagataaaa 401  Q
    || |||||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||| ||| || |||||||||||||||||||||    
42760497 ttgtgtacaagttcttcaaagtttgtgaagtgaatatttcaatgttgtttgaatggtaatttatgatgaatggaatcaaatgaataagataaaa 42760404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 10 - 401
Target Start/End: Complemental strand, 42751335 - 42750940
Alignment:
10 catatccaagcacccgtagaatttctagtttcagtgaaccctaggagactaaatttcaagaaaaagggtgaaaaaagagagttcaaggttacattaacct 109  Q
    |||||||||||||||| ||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
42751335 catatccaagcacccgcagaatttctagtttcagtggagcctaggagactaaattttaagaaaaagggtgaaaaaagagagttcaaggttacattaacct 42751236  T
110 tgaagaaaggaactacgtataagactgattacgtctttggaaaattggtttggaccgatgggaaacatcaagttgggattcctatttcaataaagtatcc 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |||||||||||||    
42751235 tgaagaaaggaactacgtataagactgattacgtctttggaaaattggtttggaccgatggaaaacatcaagttgggactcctattgcaataaagtatcc 42751136  T
210 acattagtg----agatttaggttgttgttgcattttgctaccacctgtttaaagtggtgtctcactttttctccctggtttcaataacaagacatgttg 305  Q
    |||||||||      |||||||||  || |||||||| |||| |  |||||||    |||||    |||||||||| | |||||||||   ||||||||     
42751135 acattagtggtatttatttaggttactgctgcatttt-ctacaaattgtttaagacagtgtcaatatttttctccc-gttttcaataaagggacatgttt 42751038  T
306 tattatgtacaagttcttcaaaggttgtgaagtgaatatatcaatgttgttttaatggtaatttatggtgagtgaaatcaa--atgaataagataaaa 401  Q
    | || ||||||||||||| |||| ||||||||||||||| |||||||||||| |||||||||||||| ||| || ||||||  |||||||||||||||    
42751037 tgttgtgtacaagttctttaaagtttgtgaagtgaatatttcaatgttgtttgaatggtaatttatgatgaatggaatcaaatatgaataagataaaa 42750940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 14 - 243
Target Start/End: Original strand, 42736719 - 42736947
Alignment:
14 tccaagcacccgtagaatttctagtttcagtgaaccctaggagactaaatttcaagaaaaagggtgaaaaaagagagttcaaggttacattaaccttgaa 113  Q
    |||||||||||  |||||||||| |||||||  | ||||||||||| || || | | |||||||||||||||  ||||||||||||||||| || ||||     
42736719 tccaagcacccccagaatttctaatttcagttgagcctaggagactgaaatttaggcaaaagggtgaaaaaattgagttcaaggttacatttactttgag 42736818  T
114 gaaaggaactacgtata-agactgattacgtctttggaaaattggtttggaccgatgggaaacatcaagttgggattcctatttcaataaagtatccaca 212  Q
    |  |  ||||| ||||| |||  ||||||||||| || |  ||||||||||| ||||| ||||||   || |  | ||||||| ||||||| ||| ||||    
42736819 gccacaaactaagtatataga-agattacgtcttcgggaggttggtttggactgatggaaaacatagtgtagaaactcctattgcaataaa-tattcaca 42736916  T
213 ttagtgagatttaggttgttgttgcattttg 243  Q
    ||||| || ||||||||| || |||||||||    
42736917 ttagtaaggtttaggttgatgctgcattttg 42736947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 401
Target Start/End: Original strand, 23042523 - 23042916
Alignment:
10 catatccaagcacccgtagaatttctagtttcagtgaaccctaggagactaaatttcaagaaaaagggtgaaaaaagagagttcaaggttacattaacct 109  Q
    |||||||||||||||  || |||||||||||||||||| ||||  ||||||||||| |||||||| ||||||||||||||||||||||||||||||||||    
23042523 catatccaagcacccacaggatttctagtttcagtgaagcctaacagactaaattttaagaaaaatggtgaaaaaagagagttcaaggttacattaacct 23042622  T
110 tgaagaaaggaactacgtataagactgattacgtctttggaaaattggtttggaccgatgggaaacatcaagttgggattcctatttcaataaagtatcc 209  Q
    |||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| || ||||||| |||||||||||||    
23042623 tgaagaaaggaactacatataagactgattacgtctttggaaaattgatttggaccgatggaaaacatcaagttgcgactcctattgcaataaagtatcc 23042722  T
210 acattagtg----agatttaggttgttgttgcattttgctaccacctgtttaaagtggtgtctcactttttctccctggtttcaataacaagacatgttg 305  Q
    |||||||||      |||||||||  || |||||||| |||||| ||||||||    |||||    ||||||||||   |||||||||   |||||||||    
23042723 acattagtggtatttatttaggttactgctgcatttt-ctaccaactgtttaagacagtgtcaatatttttctccc-attttcaataaagggacatgttg 23042820  T
306 tattatgtacaagttcttcaaaggttgtgaagtgaatatatcaatgttgttttaatggtaatttatggtgagtgaaatcaaatgaataagataaaa 401  Q
    | || |||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||| |  |||||||||||||||||||||    
23042821 tgttgtgtacaagttcttcaaagtttgtgaagtgaatatatcaatgttgtttgaatggtaatttatgatgaattgaatcaaatgaataagataaaa 23042916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC