View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-7 (Length: 254)

Name: F9276-LTR4-TNT-insertion-7
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9276-LTR4-TNT-insertion-7
F9276-LTR4-TNT-insertion-7
[»] chr3 (2 HSPs)
chr3 (10-244)||(49463426-49463660)
chr3 (11-65)||(10070484-10070538)
[»] chr2 (4 HSPs)
chr2 (10-244)||(33800839-33801073)
chr2 (10-244)||(31028435-31028669)
chr2 (10-232)||(33805307-33805529)
chr2 (10-232)||(33812775-33812997)
[»] chr1 (1 HSPs)
chr1 (10-142)||(2528647-2528779)


Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 49463660 - 49463426
Alignment:
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49463660 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 49463561  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49463560 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 49463461  T
210 gttaaattctccaggaaattgtcctcttctgaatt 244  Q
    |||||||||||||||||||||||||||||||||||    
49463460 gttaaattctccaggaaattgtcctcttctgaatt 49463426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 10070484 - 10070538
Alignment:
11 aatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaata 65  Q
    |||||| || |||||||||||||  |||||||||||||||||  |||||||||||    
10070484 aatgctaccgatgatgctaactttagctctgaactctttcttcacttgaccaata 10070538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 33800839 - 33801073
Alignment:
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    |||||||||| ||||| |||||||| ||||||||||||||||| |||||||||||||||||||||| |||||| ||||||| ||| |||||||||||||     
33800839 gaatgcttccgatgatactaacttcagctctgaactctttcttcccttgaccaataccttccagcttcttcacagctaattcagtcccatcaggtagaag 33800938  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| |||||||||| |||||||||||||||||||| |||   ||||||||| ||||||||||||| |||||||| |||||| | || | |||||| |||    
33800939 tcctttataaactgatccaaaacctccttgaccaagtttcacagagaagttattagttgcaacttcaagatctttatagcggaaacggattggcatgccg 33801038  T
210 gttaaattctccaggaaattgtcctcttctgaatt 244  Q
    ||||||||||||| |||||| || |||||||||||    
33801039 gttaaattctccaagaaattttcttcttctgaatt 33801073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 31028669 - 31028435
Alignment:
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| || | |||||| ||||||| | | ||||||||||||||    
31028669 gaatgcttccaatgatgctaacttcagctctgaactctttcttcccttgaccaataccttctagtttcttcacagctaattcactcccatcaggtagaac 31028570  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| | |||||||| |||||||| |||||||||||||||    |||||||| | ||||||||||| |||||||| |||||| | || | ||||||||||    
31028569 tcctttgtaaactgatccaaaaccaccttgaccaagcttcacaaagaagttattcgttgcaacttcaagatctttatagcggaaacggattggcataccg 31028470  T
210 gttaaattctccaggaaattgtcctcttctgaatt 244  Q
    ||||||||||||| ||||||||| |||||||||||    
31028469 gttaaattctccaagaaattgtcttcttctgaatt 31028435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 10 - 232
Target Start/End: Original strand, 33805307 - 33805529
Alignment:
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    ||||||| || |||||||||||||| |||| |||||||||||| ||||||||| ||||||| |||| |||||| ||||||||||| ||||||||||||||    
33805307 gaatgctaccgatgatgctaacttcagctcggaactctttcttcccttgaccattaccttctagcttcttcacagctaattgagtcccatcaggtagaac 33805406  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| |||||||||| ||||||||||||||||||||||||   ||||||||| ||||||||| ||| || ||||| |||||| | || | |||||| |||    
33805407 tcctttataaactgatccaaaacctccttgaccaagcttcacagagaagttattagttgcaatttcaagctctttatagcggaaacggattggcatgccg 33805506  T
210 gttaaattctccaggaaattgtc 232  Q
    ||||||||||||| |||||||||    
33805507 gttaaattctccaagaaattgtc 33805529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 33812997 - 33812775
Alignment:
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    ||||||| || |||||||||||||| |||| |||||||||||| ||||||||| ||||||| |||| |||||| ||||||||||| ||||||||||||||    
33812997 gaatgctaccgatgatgctaacttcagctcggaactctttcttcccttgaccattaccttctagcttcttcacagctaattgagtcccatcaggtagaac 33812898  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| |||||||||| ||||||||||||||||||||||||   ||||||||| ||||||||| ||| || ||||| |||||| | || | |||||| |||    
33812897 tcctttataaactgatccaaaacctccttgaccaagcttcacagagaagttattagttgcaatttcaagctctttatagcggaaacggattggcatgccg 33812798  T
210 gttaaattctccaggaaattgtc 232  Q
    ||||||||||||| |||||||||    
33812797 gttaaattctccaagaaattgtc 33812775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 2528647 - 2528779
Alignment:
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    |||||||||||||  ||||||||||  |  | || |||||||| ||||||||||| |||||||  | |||||| |||| ||||||| ||||   |||||     
2528647 gaatgcttccaattgtgctaacttcaaccttaaattctttcttcccttgaccaattccttccaatttcttcacagctatttgagtttcatcttttagaat 2528746  T
110 tcctctataaactgaaccaaaacctccttgacc 142  Q
    |||| |||| || ||||| ||||| ||||||||    
2528747 tcctttatataccgaaccgaaaccaccttgacc 2528779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC