View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-7 (Length: 254)

Name: F9276-LTR4-TNT-insertion-7
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9276-LTR4-TNT-insertion-7
[»] chr3 (2 HSPs)
chr3 (10-244)||(49463426-49463660)
chr3 (11-65)||(10070484-10070538)
[»] chr2 (4 HSPs)
chr2 (10-244)||(33800839-33801073)
chr2 (10-244)||(31028435-31028669)
chr2 (10-232)||(33805307-33805529)
chr2 (10-232)||(33812775-33812997)
[»] chr1 (1 HSPs)
chr1 (10-142)||(2528647-2528779)

Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr3

Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 49463660 - 49463426
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
49463660 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 49463561  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
49463560 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 49463461  T
210 gttaaattctccaggaaattgtcctcttctgaatt 244  Q
49463460 gttaaattctccaggaaattgtcctcttctgaatt 49463426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 10070484 - 10070538
11 aatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaata 65  Q
    |||||| || |||||||||||||  |||||||||||||||||  |||||||||||    
10070484 aatgctaccgatgatgctaactttagctctgaactctttcttcacttgaccaata 10070538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 131; Significance: 5e-68; HSPs: 4)
Name: chr2

Target: chr2; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 33800839 - 33801073
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    |||||||||| ||||| |||||||| ||||||||||||||||| |||||||||||||||||||||| |||||| ||||||| ||| |||||||||||||     
33800839 gaatgcttccgatgatactaacttcagctctgaactctttcttcccttgaccaataccttccagcttcttcacagctaattcagtcccatcaggtagaag 33800938  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| |||||||||| |||||||||||||||||||| |||   ||||||||| ||||||||||||| |||||||| |||||| | || | |||||| |||    
33800939 tcctttataaactgatccaaaacctccttgaccaagtttcacagagaagttattagttgcaacttcaagatctttatagcggaaacggattggcatgccg 33801038  T
210 gttaaattctccaggaaattgtcctcttctgaatt 244  Q
    ||||||||||||| |||||| || |||||||||||    
33801039 gttaaattctccaagaaattttcttcttctgaatt 33801073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 10 - 244
Target Start/End: Complemental strand, 31028669 - 31028435
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| || | |||||| ||||||| | | ||||||||||||||    
31028669 gaatgcttccaatgatgctaacttcagctctgaactctttcttcccttgaccaataccttctagtttcttcacagctaattcactcccatcaggtagaac 31028570  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| | |||||||| |||||||| |||||||||||||||    |||||||| | ||||||||||| |||||||| |||||| | || | ||||||||||    
31028569 tcctttgtaaactgatccaaaaccaccttgaccaagcttcacaaagaagttattcgttgcaacttcaagatctttatagcggaaacggattggcataccg 31028470  T
210 gttaaattctccaggaaattgtcctcttctgaatt 244  Q
    ||||||||||||| ||||||||| |||||||||||    
31028469 gttaaattctccaagaaattgtcttcttctgaatt 31028435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 10 - 232
Target Start/End: Original strand, 33805307 - 33805529
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    ||||||| || |||||||||||||| |||| |||||||||||| ||||||||| ||||||| |||| |||||| ||||||||||| ||||||||||||||    
33805307 gaatgctaccgatgatgctaacttcagctcggaactctttcttcccttgaccattaccttctagcttcttcacagctaattgagtcccatcaggtagaac 33805406  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| |||||||||| ||||||||||||||||||||||||   ||||||||| ||||||||| ||| || ||||| |||||| | || | |||||| |||    
33805407 tcctttataaactgatccaaaacctccttgaccaagcttcacagagaagttattagttgcaatttcaagctctttatagcggaaacggattggcatgccg 33805506  T
210 gttaaattctccaggaaattgtc 232  Q
    ||||||||||||| |||||||||    
33805507 gttaaattctccaagaaattgtc 33805529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 10 - 232
Target Start/End: Complemental strand, 33812997 - 33812775
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    ||||||| || |||||||||||||| |||| |||||||||||| ||||||||| ||||||| |||| |||||| ||||||||||| ||||||||||||||    
33812997 gaatgctaccgatgatgctaacttcagctcggaactctttcttcccttgaccattaccttctagcttcttcacagctaattgagtcccatcaggtagaac 33812898  T
110 tcctctataaactgaaccaaaacctccttgaccaagcttcgttgagaagttactagttgcaacttcgagatctttgtagcggtagcgaactggcataccg 209  Q
    |||| |||||||||| ||||||||||||||||||||||||   ||||||||| ||||||||| ||| || ||||| |||||| | || | |||||| |||    
33812897 tcctttataaactgatccaaaacctccttgaccaagcttcacagagaagttattagttgcaatttcaagctctttatagcggaaacggattggcatgccg 33812798  T
210 gttaaattctccaggaaattgtc 232  Q
    ||||||||||||| |||||||||    
33812797 gttaaattctccaagaaattgtc 33812775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr1

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 10 - 142
Target Start/End: Original strand, 2528647 - 2528779
10 gaatgcttccaatgatgctaacttcggctctgaactctttctttccttgaccaataccttccagctgcttcacggctaattgagttccatcaggtagaac 109  Q
    |||||||||||||  ||||||||||  |  | || |||||||| ||||||||||| |||||||  | |||||| |||| ||||||| ||||   |||||     
2528647 gaatgcttccaattgtgctaacttcaaccttaaattctttcttcccttgaccaattccttccaatttcttcacagctatttgagtttcatcttttagaat 2528746  T
110 tcctctataaactgaaccaaaacctccttgacc 142  Q
    |||| |||| || ||||| ||||| ||||||||    
2528747 tcctttatataccgaaccgaaaccaccttgacc 2528779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC

This website was viewed 94907 times since January 2019
Visitors: 2221