View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-8 (Length: 515)

Name: F9276-LTR4-TNT-insertion-8
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9276-LTR4-TNT-insertion-8
F9276-LTR4-TNT-insertion-8
[»] chr7 (1 HSPs)
chr7 (8-506)||(39733758-39734256)
[»] chr1 (1 HSPs)
chr1 (388-461)||(40044274-40044347)


Alignment Details
Target: chr7 (Bit Score: 499; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 499; E-Value: 0
Query Start/End: Original strand, 8 - 506
Target Start/End: Complemental strand, 39734256 - 39733758
Alignment:
8 tgaagaagcttaaagacacatgaagtatgacatacttggatcgatattactgacggttggcattgttgcatgggtggtgcttgcaaaacaagtgaagtaa 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39734256 tgaagaagcttaaagacacatgaagtatgacatacttggatcgatattactgacggttggcattgttgcatgggtggtgcttgcaaaacaagtgaagtaa 39734157  T
108 tttcgtttgattttgatacattgtaactgagaatcacatctaatttgcactgccacattgtttattttacttttgagaaacgtgttccttcgttcttgac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39734156 tttcgtttgattttgatacattgtaactgagaatcacatctaatttgcactgccacattgtttattttacttttgagaaacgtgttccttcgttcttgac 39734057  T
208 tgctatgtttttaacgttttaaccatttttacctatccatcttatgaaattttatcttattataattgggccgagtagttataatggtggtatgtagctt 307  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39734056 tgctatgtttttaacgttttaaccatttttacctatccatcttatgaaattttatcttattataattgggccgagtagttataatggtggtatgtagctt 39733957  T
308 gaaaattgttgttgacccttcgcttttggctgaaaaatgcctgaaaatgactcaaatgaccccatcagcagctaactgctgtggaatttaactggcggta 407  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39733956 gaaaattgttgttgacccttcgcttttggctgaaaaatgcctgaaaatgactcaaatgaccccatcagcagctaactgctgtggaatttaactggcggta 39733857  T
408 gttaattgccgatcttcaattccatccatcagcggttaagtgccgtggagcattgataatgtggagaacatgcttaccaacaggtttgtgaatcaattg 506  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39733856 gttaattgccgatcttcaattccatccatcagcggttaagtgccgtggagcattgataatgtggagaacatgcttaccaacaggtttgtgaatcaattg 39733758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 388 - 461
Target Start/End: Complemental strand, 40044347 - 40044274
Alignment:
388 gtggaatttaactggcggtagttaattgccgatcttcaattccatccatcagcggttaagtgccgtggagcatt 461  Q
    |||||| ||||| || ||||||||| ||||||||| | |||| ||||||| || ||||||||||||||||||||    
40044347 gtggaagttaaccggtggtagttaactgccgatctccgattctatccatcggcagttaagtgccgtggagcatt 40044274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105672 times since January 2019
Visitors: 2328