View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-9 (Length: 676)

Name: F9276-LTR4-TNT-insertion-9
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] F9276-LTR4-TNT-insertion-9
[»] chr1 (11 HSPs)
chr1 (9-668)||(32876308-32876967)
chr1 (466-548)||(11800831-11800911)
chr1 (315-422)||(33034633-33034741)
chr1 (601-668)||(7351912-7351979)
chr1 (347-426)||(15840932-15841011)
chr1 (519-561)||(7352138-7352180)
chr1 (347-424)||(36132752-36132829)
chr1 (571-650)||(11801171-11801250)
chr1 (474-517)||(26967646-26967689)
chr1 (345-379)||(30655589-30655623)
chr1 (519-551)||(7352229-7352261)
[»] chr6 (6 HSPs)
chr6 (337-427)||(34105394-34105484)
chr6 (573-668)||(16990368-16990463)
chr6 (470-572)||(24634224-24634326)
chr6 (315-398)||(34090373-34090455)
chr6 (514-559)||(24634090-24634135)
chr6 (334-435)||(20970412-20970514)
[»] scaffold0620 (1 HSPs)
scaffold0620 (315-421)||(3817-3922)
[»] chr7 (10 HSPs)
chr7 (310-427)||(6718750-6718867)
chr7 (573-668)||(17834914-17835009)
chr7 (573-668)||(12612038-12612133)
chr7 (356-427)||(23777664-23777735)
chr7 (504-572)||(18855090-18855158)
chr7 (601-669)||(21687144-21687212)
chr7 (573-668)||(12599363-12599458)
chr7 (573-668)||(25249057-25249152)
chr7 (519-561)||(21686992-21687033)
chr7 (346-427)||(46262138-46262219)
[»] chr5 (10 HSPs)
chr5 (466-541)||(22876037-22876112)
chr5 (592-660)||(28297819-28297887)
chr5 (328-427)||(28765603-28765702)
chr5 (589-660)||(22860486-22860557)
chr5 (592-668)||(38472059-38472135)
chr5 (519-561)||(28297989-28298030)
chr5 (238-274)||(9036581-9036617)
chr5 (360-424)||(12046239-12046303)
chr5 (517-545)||(22860288-22860316)
chr5 (503-555)||(31678858-31678910)
[»] chr4 (11 HSPs)
chr4 (494-566)||(28313163-28313235)
chr4 (573-661)||(31954597-31954685)
chr4 (588-668)||(25243277-25243357)
chr4 (328-419)||(39041275-39041366)
chr4 (348-414)||(26474830-26474896)
chr4 (356-426)||(36962644-36962714)
chr4 (476-561)||(46584809-46584894)
chr4 (573-668)||(40137675-40137770)
chr4 (346-424)||(32057097-32057175)
chr4 (518-559)||(28313369-28313410)
chr4 (519-555)||(46585091-46585127)
[»] chr3 (10 HSPs)
chr3 (358-427)||(24991946-24992015)
chr3 (360-424)||(24099360-24099424)
chr3 (573-668)||(14486547-14486642)
chr3 (4-79)||(27044025-27044100)
chr3 (592-668)||(17471848-17471924)
chr3 (362-426)||(24712620-24712684)
chr3 (315-422)||(19133732-19133839)
chr3 (573-662)||(17441584-17441673)
chr3 (591-668)||(20127766-20127843)
chr3 (356-428)||(30127242-30127314)
[»] chr8 (6 HSPs)
chr8 (514-578)||(24526412-24526476)
chr8 (356-397)||(17657031-17657072)
chr8 (387-426)||(17819864-17819903)
chr8 (518-561)||(26568170-26568213)
chr8 (319-427)||(12883571-12883678)
chr8 (465-572)||(24526516-24526624)
[»] chr2 (15 HSPs)
chr2 (573-661)||(37349595-37349683)
chr2 (573-668)||(4109083-4109178)
chr2 (601-668)||(45107940-45108007)
chr2 (601-668)||(45109659-45109726)
chr2 (476-566)||(5168942-5169032)
chr2 (590-660)||(5169271-5169341)
chr2 (588-653)||(13968774-13968839)
chr2 (359-427)||(4162052-4162119)
chr2 (519-566)||(5169077-5169124)
chr2 (519-561)||(45110001-45110043)
chr2 (356-393)||(7874306-7874343)
chr2 (504-545)||(25057109-25057150)
chr2 (469-578)||(32225801-32225910)
chr2 (519-552)||(45108207-45108240)
chr2 (395-427)||(19948013-19948045)
[»] scaffold0572 (1 HSPs)
scaffold0572 (334-435)||(6262-6364)
[»] scaffold0127 (1 HSPs)
scaffold0127 (334-435)||(31228-31330)

Alignment Details
Target: chr1 (Bit Score: 648; Significance: 0; HSPs: 11)
Name: chr1

Target: chr1; HSP #1
Raw Score: 648; E-Value: 0
Query Start/End: Original strand, 9 - 668
Target Start/End: Original strand, 32876308 - 32876967
9 taacaacattaatacaaacatcacttaaattgagaattaccaccaataccaataagaaacctaactaccaaaatcaaaggcaatacctaaaaacaaaccc 108  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32876308 taacaacactaatacaaacatcacttaaattgagaattaccaccaataccaataagaaacctaactaccaaaatcaaaggcaatacctaaaaacaaaccc 32876407  T
109 aaactcccacacttcctcatgagtggctatagaaacaaaattcaatcacctatcgaatgctaccataacccctccaataaaataaaacccttgaaaacag 208  Q
32876408 aaactcccacacttcctcatgagtggctatagaaacaaaattcaatcacctatcgaatgctaccataacccctccaataaaataaaacccttgaaaacag 32876507  T
209 gagcttaacttcgcatcaccacaactaagcccaattaaacactagaccaatgacttattccaacacgctttcagattccaccaccgctcgttctctgatc 308  Q
32876508 aagcttaacttcgcatcaccacaactaagcccaattaaacactagaccaatgacttattccaacacgctttcagattccaccaccgctcgttctctgatc 32876607  T
309 cgccaaagaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaa 408  Q
32876608 cgccaaagaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaa 32876707  T
409 tcactaaggcacccctcaatcccggactactacttggaacttggactagtataggtcgaccataccatgtgacttgtaataccttacttgaccgactagc 508  Q
32876708 tcactaaggcacccctcaatcccggactactacttggaacttggactagtataggtcgaccataccatgtgacttgtaataccttacttgaccgactagc 32876807  T
509 aagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaaccctagtctacacgcagccgtactcaaaccagacaac 608  Q
32876808 aagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaaccctagtctacacgcagccgtactcaaaccagacaac 32876907  T
609 caataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
32876908 caataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcccatta 32876967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 466 - 548
Target Start/End: Original strand, 11800831 - 11800911
466 gaccataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggc 548  Q
    |||||| |||||||||||||||||| |||||  ||| |||||||||||||||||||||| |||||||| ||||||||||||||    
11800831 gaccattccatgtgacttgtaatactttact--accaactagcaagatctcactcaacattggtttgactgttcaagtcaggc 11800911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 315 - 422
Target Start/End: Original strand, 33034633 - 33034741
315 agaagacacccttacaagcccaaaaatttaggtcaa-gaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcact 413  Q
    |||||||||| | |||| |||||||| ||| ||||| |||| |||||  ||||||||||||| ||||  ||||||||||| |||||||||  ||||| ||    
33034633 agaagacaccataacaaacccaaaaacttaagtcaaagaaactgactttcgatctcgaatcagaagtgatcgacccaccagactccataagaaaatctct 33034732  T
414 aaggcaccc 422  Q
33034733 aaggcaccc 33034741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 601 - 668
Target Start/End: Complemental strand, 7351979 - 7351912
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| ||| | ||||||||| |||||||| || ||||||||||||||||||||| |||||    
7351979 cagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgatcaaagaaaggcccatta 7351912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 347 - 426
Target Start/End: Original strand, 15840932 - 15841011
347 tcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctca 426  Q
    |||||||| |||||||||||||||||||||||||  ||  ||||||| |||| | ||||||||| |||||| ||||||||    
15840932 tcaagaaactgactcccgatctcgaatcaaaagtgatcagcccaccagactctagaaacaaatccctaaggaacccctca 15841011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 519 - 561
Target Start/End: Complemental strand, 7352180 - 7352138
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    |||||| ||||||||||||||||||||||||||||||| ||||    
7352180 tcaacattggtttgattgttcaagtcaggccagctcagttcgt 7352138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 347 - 424
Target Start/End: Original strand, 36132752 - 36132829
347 tcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    |||||||| ||||| |||||||| |||||||||   ||||||||||| |||||| ||| || |||||||| |||||||    
36132752 tcaagaaactgacttccgatctcaaatcaaaagcgatcgacccaccaaactccaaaaataattcactaagacacccct 36132829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 571 - 650
Target Start/End: Original strand, 11801171 - 11801250
571 accctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatga 650  Q
    ||||||||| |||| |  ||||||||||| |||||||||||| ||| | |||||||||  ||||||| || |||||||||    
11801171 accctagtccacacacgaccgtactcaaaacagacaaccaatgggaggctctggatcaccacttaatgggatttgaatga 11801250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 474 - 517
Target Start/End: Original strand, 26967646 - 26967689
474 catgtgacttgtaataccttacttgaccgactagcaagatctca 517  Q
    ||||||||||||||||| ||| |||||| |||||||||||||||    
26967646 catgtgacttgtaatactttagttgaccaactagcaagatctca 26967689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 345 - 379
Target Start/End: Complemental strand, 30655623 - 30655589
345 ggtcaagaaagtgactcccgatctcgaatcaaaag 379  Q
    |||||||||| ||||||||||||||||||||||||    
30655623 ggtcaagaaactgactcccgatctcgaatcaaaag 30655589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 519 - 551
Target Start/End: Complemental strand, 7352261 - 7352229
519 tcaacactggtttgattgttcaagtcaggccag 551  Q
    ||||||||||||||||||||||| |||||||||    
7352261 tcaacactggtttgattgttcaaatcaggccag 7352229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 7e-20; HSPs: 6)
Name: chr6

Target: chr6; HSP #1
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 337 - 427
Target Start/End: Complemental strand, 34105484 - 34105394
337 aaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    |||||||  ||||||||| |||||||||||||||||||||||||  ||| ||||||| |||| | ||||||||||||||||||||| ||||    
34105484 aaaatttgagtcaagaaactgactcccgatctcgaatcaaaagtgatcggcccaccaaactctagaaacaaatcactaaggcacccttcaa 34105394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 16990463 - 16990368
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||| ||| |||||||||||| |||||||||||||||| | ||||||||| |||| ||| ||  ||||||||||| |||||||| |||||    
16990463 cctagtctacgcgcggccgtactcaaagcagacaaccaataggaggctctggatcacaactcaatgggccttgaatgatcagagaaaggcccatta 16990368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 470 - 572
Target Start/End: Complemental strand, 24634326 - 24634224
470 ataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgc 569  Q
    ||||||| |||||  |||||  ||||||||||||||||  | | |||||| ||||||||||||| ||||||||||| |||| |||||||||| ||||| |    
24634326 ataccatttgactattaatattttacttgaccgactagagaaacctcacttaacactggtttgaatgttcaagtcatgccatctcagctcgtcctcactc 24634227  T
570 aac 572  Q
24634226 aac 24634224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 315 - 398
Target Start/End: Complemental strand, 34090455 - 34090373
315 agaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactc 398  Q
    |||||||||| | |||| |||||||||||  ||| ||||| ||||||||||||||||||||||| |  ||||||||||| ||||    
34090455 agaagacaccataacaa-cccaaaaatttgagtctagaaactgactcccgatctcgaatcaaaattgatcgacccaccagactc 34090373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 514 - 559
Target Start/End: Complemental strand, 24634135 - 24634090
514 ctcactcaacactggtttgattgttcaagtcaggccagctcagctc 559  Q
    |||||||||||||||||||| |||||| |||| |||||||||||||    
24634135 ctcactcaacactggtttgactgttcaggtcatgccagctcagctc 24634090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 435
Target Start/End: Original strand, 20970412 - 20970514
334 ccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa-tcccg 432  Q
    ||||||| ||| ||||||||| |||||  ||  ||||||||||| ||  ||| | ||||| |||| | ||||||||||||||| |||||||||| |||||    
20970412 ccaaaaacttaagtcaagaaactgactttcgtcctcgaatcaaatgtgatcggctcaccagactctagaaacaaatcactaagtcacccctcaactcccg 20970511  T
433 gac 435  Q
20970512 gac 20970514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: scaffold0620

Target: scaffold0620; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 315 - 421
Target Start/End: Complemental strand, 3922 - 3817
315 agaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcacta 414  Q
    |||||||||| | |||| |||||||||||  ||||||||| ||||||||||||||||||||||| |  ||| ||||||| |||| | ||||||||||||     
3922 agaagacaccataacaa-cccaaaaatttgagtcaagaaactgactcccgatctcgaatcaaaattgatcggcccaccagactctaaaaacaaatcactg 3824  T
415 aggcacc 421  Q
3823 aggcacc 3817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 7e-17; HSPs: 10)
Name: chr7

Target: chr7; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 310 - 427
Target Start/End: Complemental strand, 6718867 - 6718750
310 gccaaagaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaat 409  Q
    |||| |||||||||| | ||||||||||| ||||  ||||||||| |||||||  |||||||||||||| |  |||| |||||  |||||||||||||||    
6718867 gccagagaagacaccataacaagcccaaatatttgagtcaagaaactgactcctcatctcgaatcaaaattgatcgatccaccggactccataaacaaat 6718768  T
410 cactaaggcacccctcaa 427  Q
    || | ||| |||||||||    
6718767 cattgaggtacccctcaa 6718750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 573 - 668
Target Start/End: Original strand, 17834914 - 17835009
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| |||||||||||||||| | ||||||||| |||||| | ||  | |||||||||||||||||| |||||    
17834914 cctagtccacgcgcggccgtactcaaagcagacaaccaataggaggatctggatcacaacttattgggcctagaatgatcaaagaaaggcccatta 17835009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 12612133 - 12612038
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| ||| |||||||| |||||||||||||||| | ||||||||| |||||| | ||  | ||||||||| |||||||| |||||    
12612133 cctagtccacgcgcggccatactcaaagcagacaaccaataggaggctctggatcacaacttattgggcctagaatgatcagagaaaggcccatta 12612038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 356 - 427
Target Start/End: Original strand, 23777664 - 23777735
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||| ||||||||||| ||||||   |||||| |||| ||| ||||||||||| |||||||||||||||||    
23777664 tgacttccgatctcgaagcaaaagcgatcgaccaaccaaacttcataaacaaataactaaggcacccctcaa 23777735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 504 - 572
Target Start/End: Complemental strand, 18855158 - 18855090
504 ctagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaac 572  Q
    ||||| |||||  ||||||||||||||||| ||||||||||| | ||||| |||| |||||||| ||||    
18855158 ctagcgagatccaactcaacactggtttgactgttcaagtcatgtcagctaagcttgttctcactcaac 18855090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 601 - 669
Target Start/End: Original strand, 21687144 - 21687212
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcattag 669  Q
    |||||||||||| ||| | | ||||||| |||||||| || ||||||||||||||||||| | ||||||    
21687144 cagacaaccaatgggaggctatggatcacaacttaatgggctttgaatgatcaaagaaagacccattag 21687212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 12599458 - 12599363
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| ||||||||  || |||||||||||||||| | ||||||||| |||||| | ||  | ||||||||| |||||||| |||||    
12599458 cctagtccacgcgcggccgtactttaagcagacaaccaataggaggctctggatcacaacttattgggcctagaatgatcagagaaaggcccatta 12599363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 25249152 - 25249057
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| |||||||||||||||| | | || |||| |||||| | ||  | ||||||||| |||||||| |||||    
25249152 cctagtccacgcgcggccgtactcaaagcagacaaccaataggaggctttgtatcacaacttattgggcctagaatgatcagagaaaggcccatta 25249057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 561
Target Start/End: Original strand, 21686992 - 21687033
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    |||||||| |||||||||||||||||| |||||||||||||||    
21686992 tcaacactagtttgattgttcaagtca-gccagctcagctcgt 21687033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 427
Target Start/End: Original strand, 46262138 - 46262219
346 gtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||||||| |  ||||||||||||||||||||||  ||| ||||||| |||||  | || |||||  ||||||||||||||    
46262138 gtcaagaaactagctcccgatctcgaatcaaaagtgatcggcccaccagactcccaacaccaatcaaaaaggcacccctcaa 46262219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 10)
Name: chr5

Target: chr5; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 466 - 541
Target Start/End: Original strand, 22876037 - 22876112
466 gaccataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaa 541  Q
    ||||||||||||||||||||||||  | ||||||||||| | |||||||||||| |||||||| |||| |||||||    
22876037 gaccataccatgtgacttgtaatagttgacttgaccgaccaacaagatctcacttaacactgggttgactgttcaa 22876112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 592 - 660
Target Start/End: Complemental strand, 28297887 - 28297819
592 tactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaag 660  Q
    |||||||| |||||||||||||||| | ||||||||| |||||||| ||  ||||||||||||||||||    
28297887 tactcaaaacagacaaccaataggaggctctggatcacaacttaatgggccttgaatgatcaaagaaag 28297819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 328 - 427
Target Start/End: Original strand, 28765603 - 28765702
328 acaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||||||||||| ||| ||||||||| |||||| ||||||||||||||||||  || | |||||| | || | ||| |||||| || ||||||||||||    
28765603 acaagcccaaaaacttaagtcaagaaactgactctcgatctcgaatcaaaagtgatcaatccaccagaatctagaaaaaaatcattagggcacccctcaa 28765702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 589 - 660
Target Start/End: Original strand, 22860486 - 22860557
589 ccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaag 660  Q
    ||||||||||| |||||||||||||||| | ||| ||||| |||||||| ||  ||||||||||| ||||||    
22860486 ccgtactcaaagcagacaaccaataggaggctctagatcacaacttaatgggccttgaatgatcagagaaag 22860557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 592 - 668
Target Start/End: Original strand, 38472059 - 38472135
592 tactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||| |||||||||||||||| | ||||||||| |||||||| ||  ||| ||||||| | |||||| |||||    
38472059 tactcaaagcagacaaccaataggaggctctggatcacaacttaatgggccttggatgatcagataaaggcccatta 38472135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 561
Target Start/End: Complemental strand, 28298030 - 28297989
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    ||||||||||||||||||||||||||| |||||| ||||||||    
28298030 tcaacactggtttgattgttcaagtcaagccagc-cagctcgt 28297989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 238 - 274
Target Start/End: Original strand, 9036581 - 9036617
238 cccaattaaacactagaccaatgacttattccaacac 274  Q
    |||||||||||||| || |||||||||||||||||||    
9036581 cccaattaaacactcgaacaatgacttattccaacac 9036617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 360 - 424
Target Start/End: Complemental strand, 12046303 - 12046239
360 tcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    |||||||||||||||||||||  ||| ||||||| ||| |  || |||||||||| |||||||||    
12046303 tcccgatctcgaatcaaaagtgatcggcccaccaaacttccgaatcaaatcactatggcacccct 12046239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 517 - 545
Target Start/End: Original strand, 22860288 - 22860316
517 actcaacactggtttgattgttcaagtca 545  Q
22860288 actcaacactggtttgattgttcaagtca 22860316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 503 - 555
Target Start/End: Original strand, 31678858 - 31678910
503 actagcaagatctcactcaacactggtttgattgttcaagtcaggccagctca 555  Q
    |||| ||||||||||||||||||  |||||| ||||||| |||||||| ||||    
31678858 actatcaagatctcactcaacacgagtttgactgttcaactcaggccaactca 31678910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 11)
Name: chr4

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 494 - 566
Target Start/End: Original strand, 28313163 - 28313235
494 acttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctca 566  Q
    |||||||| |||||||||||||||||||||| || ||||||||||| ||| | || |||||||||||| ||||    
28313163 acttgaccaactagcaagatctcactcaacattgttttgattgttcgagtaatgctagctcagctcgtcctca 28313235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 573 - 661
Target Start/End: Original strand, 31954597 - 31954685
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaagg 661  Q
    ||||||| |||||| |||||||||||| |||||||||||||||| | ||||||||| |||||| | ||  | ||||||||| |||||||    
31954597 cctagtccacacgcggccgtactcaaagcagacaaccaataggaggctctggatcacaacttattgggcctagaatgatcagagaaagg 31954685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 588 - 668
Target Start/End: Original strand, 25243277 - 25243357
588 gccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| |  ||||||||||||| | ||||||||| |||||||| ||  ||||||||||| |||||||| |||||    
25243277 gccgtactcaaaacgaacaaccaataggaggctctggatcacaacttaatgggccttgaatgatcagagaaaggcccatta 25243357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 328 - 419
Target Start/End: Original strand, 39041275 - 39041366
328 acaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggca 419  Q
    |||||||||| || ||  ||| ||||| ||||||| |||||||||||||||||  ||| ||||||| ||||  ||||||||||| |||||||    
39041275 acaagcccaacaacttgagtctagaaactgactcctgatctcgaatcaaaagtgatcggcccaccagactctgtaaacaaatcattaaggca 39041366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 414
Target Start/End: Complemental strand, 26474896 - 26474830
348 caagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcacta 414  Q
    ||||||| | |||| ||||||||||||||||||  ||| ||||||| |||||| |||||||||||||    
26474896 caagaaactaactctcgatctcgaatcaaaagtgatcggcccaccaaactccaaaaacaaatcacta 26474830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 356 - 426
Target Start/End: Original strand, 36962644 - 36962714
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctca 426  Q
    ||||||| |||||||||||||||||  ||| ||||||| |||||| || ||||||| ||||| ||||||||    
36962644 tgactcctgatctcgaatcaaaagtaatcggcccaccagactccaaaaccaaatcagtaaggtacccctca 36962714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 476 - 561
Target Start/End: Original strand, 46584809 - 46584894
476 tgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    ||||||| ||||||| |||||| ||  |||| ||||||  |||| |||||||||||||   |||||||||||||| ||||||||||    
46584809 tgtgactcgtaatactttactttactaactaacaagataacactgaacactggtttgacatttcaagtcaggccacctcagctcgt 46584894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 573 - 668
Target Start/End: Original strand, 40137675 - 40137770
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| || ||||||||||||| | ||||||||| |||||| | ||  | ||||||||  |||||||| |||||    
40137675 cctagtccacgcgcggccgtactcaaagcacacaaccaataggaggctctggatcacaacttattgggcctagaatgatcggagaaaggcccatta 40137770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 346 - 424
Target Start/End: Complemental strand, 32057175 - 32057097
346 gtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    ||||||||| ||||| |||||||| ||||||||||  ||| || || | ||| ||||||||||||| ||||||| ||||    
32057175 gtcaagaaactgacttccgatctcaaatcaaaagtgatcgtccaactaaacttcataaacaaatcattaaggcaaccct 32057097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 518 - 559
Target Start/End: Original strand, 28313369 - 28313410
518 ctcaacactggtttgattgttcaagtcaggccagctcagctc 559  Q
    ||||||| |||||||| ||||||||||| |||||||||||||    
28313369 ctcaacattggtttgactgttcaagtcatgccagctcagctc 28313410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 519 - 555
Target Start/End: Original strand, 46585091 - 46585127
519 tcaacactggtttgattgttcaagtcaggccagctca 555  Q
    ||||||||||||||| |||||||||||| ||||||||    
46585091 tcaacactggtttgactgttcaagtcagaccagctca 46585127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000004; HSPs: 10)
Name: chr3

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 24991946 - 24992015
358 actcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    |||||| |||||||||||||||  |||| ||||||||| |||| |||||||||||||||| ||| |||||    
24991946 actccctatctcgaatcaaaagcggtcggcccaccataatccaaaaacaaatcactaaggtacctctcaa 24992015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 424
Target Start/End: Original strand, 24099360 - 24099424
360 tcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    ||||||| |||||||||||||  ||| ||||||| |||| |||||||||||| ||||||||||||    
24099360 tcccgatatcgaatcaaaagtgatcggcccaccagactctataaacaaatcattaaggcacccct 24099424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 14486642 - 14486547
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| ||||||||||||  || |||||||||||| | ||||||||| |||||||| ||  | ||||||||| |||||||| |||||    
14486642 cctagtccacgcgcggccgtactcaaaggaggcaaccaataggaggctctggatcacaacttaatgggcctagaatgatcagagaaaggcccatta 14486547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 27044100 - 27044025
4 aacactaacaacattaatacaaacatcacttaaattgagaattaccaccaataccaataagaaacctaactaccaa 79  Q
    |||| ||| |||| |||| |||||| ||| ||||||||||  |||||||||  |||||||||||||||||||||||    
27044100 aacaataataacagtaattcaaacaccacctaaattgagagctaccaccaaccccaataagaaacctaactaccaa 27044025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 592 - 668
Target Start/End: Original strand, 17471848 - 17471924
592 tactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||| || ||||||||||||| | ||||||||| |||||||| ||  | ||||||||| |||||||| |||||    
17471848 tactcaaagcaaacaaccaataggaggctctggatcacaacttaatgggcctagaatgatcagagaaaggcccatta 17471924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 362 - 426
Target Start/End: Complemental strand, 24712684 - 24712620
362 ccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctca 426  Q
    |||||||||||| |||| |   || |||||||||||||| |||||||||| ||||||||||||||    
24712684 ccgatctcgaataaaaaatgaccggcccaccatactccagaaacaaatcagtaaggcacccctca 24712620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 315 - 422
Target Start/End: Original strand, 19133732 - 19133839
315 agaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcacta 414  Q
    |||||||||| | ||||||| ||||||||  | ||| ||| ||||| || | ||||||||||||||  || |||||||| | |  | |||||||||||||    
19133732 agaagacaccgtaacaagccaaaaaatttgagccaataaactgacttccaaactcgaatcaaaagtgatctacccaccaaatttgagaaacaaatcacta 19133831  T
415 aggcaccc 422  Q
19133832 aggcaccc 19133839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 573 - 662
Target Start/End: Original strand, 17441584 - 17441673
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggc 662  Q
    ||||||| || ||| ||| |||||||| ||||||||||| |||| | ||| ||||| |||||||| ||  | ||||||||| ||||||||    
17441584 cctagtccacgcgcggccttactcaaagcagacaaccaaaaggaggctctagatcacaacttaatgggcctagaatgatcagagaaaggc 17441673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 591 - 668
Target Start/End: Complemental strand, 20127843 - 20127766
591 gtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||||| ||||||||| | |||| | |||||||||||||||||| ||  | ||||||| | |||||||| |||||    
20127843 gtactcaaagcagacaaccgaaaggaggctctggatcataacttaatgggcctagaatgattagagaaaggcccatta 20127766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 356 - 428
Target Start/End: Complemental strand, 30127314 - 30127242
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaat 428  Q
    ||||||||||||||||||||||||   ||| | ||||| |||||  |||||||||| ||  ||||||||||||    
30127314 tgactcccgatctcgaatcaaaagcgatcggctcaccagactcccgaaacaaatcaatagagcacccctcaat 30127242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 6)
Name: chr8

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 514 - 578
Target Start/End: Complemental strand, 24526476 - 24526412
514 ctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaaccctagt 578  Q
    |||||||||||||||||||| ||||||||||| | ||||| | ||||||||||| |||| |||||    
24526476 ctcactcaacactggtttgactgttcaagtcatgtcagcttaactcgttctcactcaacactagt 24526412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 397
Target Start/End: Original strand, 17657031 - 17657072
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatact 397  Q
    |||||||||||||||||||||||||  |||||||||||||||    
17657031 tgactcccgatctcgaatcaaaagtgatcgacccaccatact 17657072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 426
Target Start/End: Original strand, 17819864 - 17819903
387 cccaccatactccataaacaaatcactaaggcacccctca 426  Q
    ||||||| ||||||||||||||||| ||||||||||||||    
17819864 cccaccagactccataaacaaatcagtaaggcacccctca 17819903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 518 - 561
Target Start/End: Original strand, 26568170 - 26568213
518 ctcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    |||||||||||||||| |||| |||||| |||||||||||||||    
26568170 ctcaacactggtttgactgtttaagtcatgccagctcagctcgt 26568213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 319 - 427
Target Start/End: Complemental strand, 12883678 - 12883571
319 gacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggc 418  Q
    |||||| | |||| |||||||| ||| |||| || | |||||  ||||||||||||||| |   |||  |||||| ||||||||||||||| | ||||||    
12883678 gacaccataacaaacccaaaaacttaagtcacgacactgactttcgatctcgaatcaaa-gcgatcggtccaccagactccataaacaaattattaaggc 12883580  T
419 acccctcaa 427  Q
12883579 acccctcaa 12883571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 465 - 572
Target Start/End: Complemental strand, 24526624 - 24526516
465 cgaccataccatgtgacttgtaatacctt-acttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttc 563  Q
    ||||||| | ||||| ||||||||| ||| || |||| | |||||||||||  ||| | ||| ||||||| ||||||||||| | ||||| ||||||| |    
24526624 cgaccatgctatgtggcttgtaatatcttgacctgactggctagcaagatccaacttagcaccggtttgactgttcaagtcatgtcagcttagctcgtcc 24526525  T
564 tcacgcaac 572  Q
    |||| ||||    
24526524 tcactcaac 24526516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.00000000002; HSPs: 15)
Name: chr2

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 573 - 661
Target Start/End: Original strand, 37349595 - 37349683
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaagg 661  Q
    ||||||| || ||| |||||||||||| ||||||||||||| || | ||||||||| |||||| | ||| | ||||||||| |||||||    
37349595 cctagtccacgcgcggccgtactcaaagcagacaaccaatatgaggctctggatcacaacttattgggtctagaatgatcagagaaagg 37349683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 4109178 - 4109083
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| |||||||||||||||| | ||||||||| |||||| | ||  |  |||||||| |||||||| |||||    
4109178 cctagtccacgcgcggccgtactcaaagcagacaaccaataggaggctctggatcacaacttattgggcctaaaatgatcagagaaaggcccatta 4109083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 601 - 668
Target Start/End: Complemental strand, 45108007 - 45107940
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| ||| | ||||||||| |||||||| || |||||||||||| |||||||| |||||    
45108007 cagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgatcagagaaaggcccatta 45107940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 601 - 668
Target Start/End: Complemental strand, 45109726 - 45109659
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| ||| | ||||||||| |||||||| || |||||||||||| |||||||| |||||    
45109726 cagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgatcagagaaaggcccatta 45109659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 476 - 566
Target Start/End: Original strand, 5168942 - 5169032
476 tgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctca 566  Q
    ||||||||||||||| ||| |||||  |||||||||| |||| |||||| |||||||| | || |||| |||||| |||| ||||| ||||    
5168942 tgtgacttgtaatactttatttgactaactagcaagacctcattcaacaatggtttgactatttaagttaggccaactcaactcgtcctca 5169032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 590 - 660
Target Start/End: Original strand, 5169271 - 5169341
590 cgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaag 660  Q
    |||||||||| |||||||||||| ||| | ||||||||| |||||||| || |||||||||| | ||||||    
5169271 cgtactcaaaacagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgattagagaaag 5169341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 588 - 653
Target Start/End: Original strand, 13968774 - 13968839
588 gccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatca 653  Q
    |||||||||||| || ||||||||||||| | ||||||||| |||||||| ||  |||||||||||    
13968774 gccgtactcaaaacatacaaccaataggaggctctggatcacaacttaatgggccttgaatgatca 13968839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 427
Target Start/End: Original strand, 4162052 - 4162119
359 ctcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||||||||||||||||||||  ||| ||||||| |||||  | |||||||||| |||||||||||||    
4162052 ctcccgatctcgaatcaaaagtgatcggcccaccagactcccaacacaaatcact-aggcacccctcaa 4162119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 519 - 566
Target Start/End: Original strand, 5169077 - 5169124
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgttctca 566  Q
    |||||||||||||||| ||||||||||| |||||||| ||||| ||||    
5169077 tcaacactggtttgatcgttcaagtcagaccagctcaactcgtcctca 5169124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 561
Target Start/End: Complemental strand, 45110043 - 45110001
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    ||||||||| ||||||||||||| |||||||| ||||||||||    
45110043 tcaacactgatttgattgttcaaatcaggccaactcagctcgt 45110001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 356 - 393
Target Start/End: Complemental strand, 7874343 - 7874306
356 tgactcccgatctcgaatcaaaagtcgtcgacccacca 393  Q
    |||||||||||||||||||||||||  |||||||||||    
7874343 tgactcccgatctcgaatcaaaagtgatcgacccacca 7874306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 504 - 545
Target Start/End: Complemental strand, 25057150 - 25057109
504 ctagcaagatctcactcaacactggtttgattgttcaagtca 545  Q
    ||||||||||||||||||||||| | |||| |||||||||||    
25057150 ctagcaagatctcactcaacactagcttgactgttcaagtca 25057109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 469 - 578
Target Start/End: Original strand, 32225801 - 32225910
469 cataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacg 568  Q
    ||||| ||||||||| |||||  |  ||||||||||||| ||||||| ||||||| | || ||||||||| |||| | || ||||||| | || |||||     
32225801 catactatgtgacttataatagttggcttgaccgactagtaagatcttactcaactccgggttgattgtttaagttatgcaagctcagttagtcctcact 32225900  T
569 caaccctagt 578  Q
    |||| |||||    
32225901 caacactagt 32225910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 519 - 552
Target Start/End: Complemental strand, 45108240 - 45108207
519 tcaacactggtttgattgttcaagtcaggccagc 552  Q
    ||||||||||||||||||||||| ||||||||||    
45108240 tcaacactggtttgattgttcaaatcaggccagc 45108207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 395 - 427
Target Start/End: Original strand, 19948013 - 19948045
395 actccataaacaaatcactaaggcacccctcaa 427  Q
    |||||| ||||||||||||||||||||||||||    
19948013 actccagaaacaaatcactaaggcacccctcaa 19948045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0572 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0572

Target: scaffold0572; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 435
Target Start/End: Original strand, 6262 - 6364
334 ccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa-tcccg 432  Q
    ||||||| ||| ||||||||| |||||  ||  ||||||||||| ||  ||| | ||||| |||| | ||||||||||||||| |||||||||| |||||    
6262 ccaaaaacttaagtcaagaaactgactttcgtcctcgaatcaaatgtgatcggctcaccagactctagaaacaaatcactaagtcacccctcaactcccg 6361  T
433 gac 435  Q
6362 gac 6364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0127 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0127

Target: scaffold0127; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 435
Target Start/End: Complemental strand, 31330 - 31228
334 ccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa-tcccg 432  Q
    ||||||| ||| ||||||||| |||||  ||  ||||||||||| ||  ||| | ||||| |||| | ||||||||||||||| |||||||||| |||||    
31330 ccaaaaacttaagtcaagaaactgactttcgtcctcgaatcaaatgtgatcggctcaccagactctagaaacaaatcactaagtcacccctcaactcccg 31231  T
433 gac 435  Q
31230 gac 31228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

© Noble Research Institute, LLC