View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9276-LTR4-TNT-insertion-9 (Length: 676)

Name: F9276-LTR4-TNT-insertion-9
Description: F9276-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9276-LTR4-TNT-insertion-9
F9276-LTR4-TNT-insertion-9
[»] chr1 (11 HSPs)
chr1 (9-668)||(32876308-32876967)
chr1 (466-548)||(11800831-11800911)
chr1 (315-422)||(33034633-33034741)
chr1 (601-668)||(7351912-7351979)
chr1 (347-426)||(15840932-15841011)
chr1 (519-561)||(7352138-7352180)
chr1 (347-424)||(36132752-36132829)
chr1 (571-650)||(11801171-11801250)
chr1 (474-517)||(26967646-26967689)
chr1 (345-379)||(30655589-30655623)
chr1 (519-551)||(7352229-7352261)
[»] chr6 (6 HSPs)
chr6 (337-427)||(34105394-34105484)
chr6 (573-668)||(16990368-16990463)
chr6 (470-572)||(24634224-24634326)
chr6 (315-398)||(34090373-34090455)
chr6 (514-559)||(24634090-24634135)
chr6 (334-435)||(20970412-20970514)
[»] scaffold0620 (1 HSPs)
scaffold0620 (315-421)||(3817-3922)
[»] chr7 (10 HSPs)
chr7 (310-427)||(6718750-6718867)
chr7 (573-668)||(17834914-17835009)
chr7 (573-668)||(12612038-12612133)
chr7 (356-427)||(23777664-23777735)
chr7 (504-572)||(18855090-18855158)
chr7 (601-669)||(21687144-21687212)
chr7 (573-668)||(12599363-12599458)
chr7 (573-668)||(25249057-25249152)
chr7 (519-561)||(21686992-21687033)
chr7 (346-427)||(46262138-46262219)
[»] chr5 (10 HSPs)
chr5 (466-541)||(22876037-22876112)
chr5 (592-660)||(28297819-28297887)
chr5 (328-427)||(28765603-28765702)
chr5 (589-660)||(22860486-22860557)
chr5 (592-668)||(38472059-38472135)
chr5 (519-561)||(28297989-28298030)
chr5 (238-274)||(9036581-9036617)
chr5 (360-424)||(12046239-12046303)
chr5 (517-545)||(22860288-22860316)
chr5 (503-555)||(31678858-31678910)
[»] chr4 (11 HSPs)
chr4 (494-566)||(28313163-28313235)
chr4 (573-661)||(31954597-31954685)
chr4 (588-668)||(25243277-25243357)
chr4 (328-419)||(39041275-39041366)
chr4 (348-414)||(26474830-26474896)
chr4 (356-426)||(36962644-36962714)
chr4 (476-561)||(46584809-46584894)
chr4 (573-668)||(40137675-40137770)
chr4 (346-424)||(32057097-32057175)
chr4 (518-559)||(28313369-28313410)
chr4 (519-555)||(46585091-46585127)
[»] chr3 (10 HSPs)
chr3 (358-427)||(24991946-24992015)
chr3 (360-424)||(24099360-24099424)
chr3 (573-668)||(14486547-14486642)
chr3 (4-79)||(27044025-27044100)
chr3 (592-668)||(17471848-17471924)
chr3 (362-426)||(24712620-24712684)
chr3 (315-422)||(19133732-19133839)
chr3 (573-662)||(17441584-17441673)
chr3 (591-668)||(20127766-20127843)
chr3 (356-428)||(30127242-30127314)
[»] chr8 (6 HSPs)
chr8 (514-578)||(24526412-24526476)
chr8 (356-397)||(17657031-17657072)
chr8 (387-426)||(17819864-17819903)
chr8 (518-561)||(26568170-26568213)
chr8 (319-427)||(12883571-12883678)
chr8 (465-572)||(24526516-24526624)
[»] chr2 (15 HSPs)
chr2 (573-661)||(37349595-37349683)
chr2 (573-668)||(4109083-4109178)
chr2 (601-668)||(45107940-45108007)
chr2 (601-668)||(45109659-45109726)
chr2 (476-566)||(5168942-5169032)
chr2 (590-660)||(5169271-5169341)
chr2 (588-653)||(13968774-13968839)
chr2 (359-427)||(4162052-4162119)
chr2 (519-566)||(5169077-5169124)
chr2 (519-561)||(45110001-45110043)
chr2 (356-393)||(7874306-7874343)
chr2 (504-545)||(25057109-25057150)
chr2 (469-578)||(32225801-32225910)
chr2 (519-552)||(45108207-45108240)
chr2 (395-427)||(19948013-19948045)
[»] scaffold0572 (1 HSPs)
scaffold0572 (334-435)||(6262-6364)
[»] scaffold0127 (1 HSPs)
scaffold0127 (334-435)||(31228-31330)


Alignment Details
Target: chr1 (Bit Score: 648; Significance: 0; HSPs: 11)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 648; E-Value: 0
Query Start/End: Original strand, 9 - 668
Target Start/End: Original strand, 32876308 - 32876967
Alignment:
9 taacaacattaatacaaacatcacttaaattgagaattaccaccaataccaataagaaacctaactaccaaaatcaaaggcaatacctaaaaacaaaccc 108  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32876308 taacaacactaatacaaacatcacttaaattgagaattaccaccaataccaataagaaacctaactaccaaaatcaaaggcaatacctaaaaacaaaccc 32876407  T
109 aaactcccacacttcctcatgagtggctatagaaacaaaattcaatcacctatcgaatgctaccataacccctccaataaaataaaacccttgaaaacag 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32876408 aaactcccacacttcctcatgagtggctatagaaacaaaattcaatcacctatcgaatgctaccataacccctccaataaaataaaacccttgaaaacag 32876507  T
209 gagcttaacttcgcatcaccacaactaagcccaattaaacactagaccaatgacttattccaacacgctttcagattccaccaccgctcgttctctgatc 308  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32876508 aagcttaacttcgcatcaccacaactaagcccaattaaacactagaccaatgacttattccaacacgctttcagattccaccaccgctcgttctctgatc 32876607  T
309 cgccaaagaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaa 408  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32876608 cgccaaagaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaa 32876707  T
409 tcactaaggcacccctcaatcccggactactacttggaacttggactagtataggtcgaccataccatgtgacttgtaataccttacttgaccgactagc 508  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32876708 tcactaaggcacccctcaatcccggactactacttggaacttggactagtataggtcgaccataccatgtgacttgtaataccttacttgaccgactagc 32876807  T
509 aagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaaccctagtctacacgcagccgtactcaaaccagacaac 608  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32876808 aagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaaccctagtctacacgcagccgtactcaaaccagacaac 32876907  T
609 caataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
32876908 caataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcccatta 32876967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 466 - 548
Target Start/End: Original strand, 11800831 - 11800911
Alignment:
466 gaccataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggc 548  Q
    |||||| |||||||||||||||||| |||||  ||| |||||||||||||||||||||| |||||||| ||||||||||||||    
11800831 gaccattccatgtgacttgtaatactttact--accaactagcaagatctcactcaacattggtttgactgttcaagtcaggc 11800911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 315 - 422
Target Start/End: Original strand, 33034633 - 33034741
Alignment:
315 agaagacacccttacaagcccaaaaatttaggtcaa-gaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcact 413  Q
    |||||||||| | |||| |||||||| ||| ||||| |||| |||||  ||||||||||||| ||||  ||||||||||| |||||||||  ||||| ||    
33034633 agaagacaccataacaaacccaaaaacttaagtcaaagaaactgactttcgatctcgaatcagaagtgatcgacccaccagactccataagaaaatctct 33034732  T
414 aaggcaccc 422  Q
    |||||||||    
33034733 aaggcaccc 33034741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 601 - 668
Target Start/End: Complemental strand, 7351979 - 7351912
Alignment:
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| ||| | ||||||||| |||||||| || ||||||||||||||||||||| |||||    
7351979 cagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgatcaaagaaaggcccatta 7351912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 347 - 426
Target Start/End: Original strand, 15840932 - 15841011
Alignment:
347 tcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctca 426  Q
    |||||||| |||||||||||||||||||||||||  ||  ||||||| |||| | ||||||||| |||||| ||||||||    
15840932 tcaagaaactgactcccgatctcgaatcaaaagtgatcagcccaccagactctagaaacaaatccctaaggaacccctca 15841011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 519 - 561
Target Start/End: Complemental strand, 7352180 - 7352138
Alignment:
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    |||||| ||||||||||||||||||||||||||||||| ||||    
7352180 tcaacattggtttgattgttcaagtcaggccagctcagttcgt 7352138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 347 - 424
Target Start/End: Original strand, 36132752 - 36132829
Alignment:
347 tcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    |||||||| ||||| |||||||| |||||||||   ||||||||||| |||||| ||| || |||||||| |||||||    
36132752 tcaagaaactgacttccgatctcaaatcaaaagcgatcgacccaccaaactccaaaaataattcactaagacacccct 36132829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 571 - 650
Target Start/End: Original strand, 11801171 - 11801250
Alignment:
571 accctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatga 650  Q
    ||||||||| |||| |  ||||||||||| |||||||||||| ||| | |||||||||  ||||||| || |||||||||    
11801171 accctagtccacacacgaccgtactcaaaacagacaaccaatgggaggctctggatcaccacttaatgggatttgaatga 11801250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 474 - 517
Target Start/End: Original strand, 26967646 - 26967689
Alignment:
474 catgtgacttgtaataccttacttgaccgactagcaagatctca 517  Q
    ||||||||||||||||| ||| |||||| |||||||||||||||    
26967646 catgtgacttgtaatactttagttgaccaactagcaagatctca 26967689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 345 - 379
Target Start/End: Complemental strand, 30655623 - 30655589
Alignment:
345 ggtcaagaaagtgactcccgatctcgaatcaaaag 379  Q
    |||||||||| ||||||||||||||||||||||||    
30655623 ggtcaagaaactgactcccgatctcgaatcaaaag 30655589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 519 - 551
Target Start/End: Complemental strand, 7352261 - 7352229
Alignment:
519 tcaacactggtttgattgttcaagtcaggccag 551  Q
    ||||||||||||||||||||||| |||||||||    
7352261 tcaacactggtttgattgttcaaatcaggccag 7352229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 51; Significance: 7e-20; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 51; E-Value: 7e-20
Query Start/End: Original strand, 337 - 427
Target Start/End: Complemental strand, 34105484 - 34105394
Alignment:
337 aaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    |||||||  ||||||||| |||||||||||||||||||||||||  ||| ||||||| |||| | ||||||||||||||||||||| ||||    
34105484 aaaatttgagtcaagaaactgactcccgatctcgaatcaaaagtgatcggcccaccaaactctagaaacaaatcactaaggcacccttcaa 34105394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 16990463 - 16990368
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||| ||| |||||||||||| |||||||||||||||| | ||||||||| |||| ||| ||  ||||||||||| |||||||| |||||    
16990463 cctagtctacgcgcggccgtactcaaagcagacaaccaataggaggctctggatcacaactcaatgggccttgaatgatcagagaaaggcccatta 16990368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 470 - 572
Target Start/End: Complemental strand, 24634326 - 24634224
Alignment:
470 ataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgc 569  Q
    ||||||| |||||  |||||  ||||||||||||||||  | | |||||| ||||||||||||| ||||||||||| |||| |||||||||| ||||| |    
24634326 ataccatttgactattaatattttacttgaccgactagagaaacctcacttaacactggtttgaatgttcaagtcatgccatctcagctcgtcctcactc 24634227  T
570 aac 572  Q
    |||    
24634226 aac 24634224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 315 - 398
Target Start/End: Complemental strand, 34090455 - 34090373
Alignment:
315 agaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactc 398  Q
    |||||||||| | |||| |||||||||||  ||| ||||| ||||||||||||||||||||||| |  ||||||||||| ||||    
34090455 agaagacaccataacaa-cccaaaaatttgagtctagaaactgactcccgatctcgaatcaaaattgatcgacccaccagactc 34090373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 514 - 559
Target Start/End: Complemental strand, 24634135 - 24634090
Alignment:
514 ctcactcaacactggtttgattgttcaagtcaggccagctcagctc 559  Q
    |||||||||||||||||||| |||||| |||| |||||||||||||    
24634135 ctcactcaacactggtttgactgttcaggtcatgccagctcagctc 24634090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 435
Target Start/End: Original strand, 20970412 - 20970514
Alignment:
334 ccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa-tcccg 432  Q
    ||||||| ||| ||||||||| |||||  ||  ||||||||||| ||  ||| | ||||| |||| | ||||||||||||||| |||||||||| |||||    
20970412 ccaaaaacttaagtcaagaaactgactttcgtcctcgaatcaaatgtgatcggctcaccagactctagaaacaaatcactaagtcacccctcaactcccg 20970511  T
433 gac 435  Q
    |||    
20970512 gac 20970514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0620 (Bit Score: 47; Significance: 2e-17; HSPs: 1)
Name: scaffold0620
Description:

Target: scaffold0620; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 315 - 421
Target Start/End: Complemental strand, 3922 - 3817
Alignment:
315 agaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcacta 414  Q
    |||||||||| | |||| |||||||||||  ||||||||| ||||||||||||||||||||||| |  ||| ||||||| |||| | ||||||||||||     
3922 agaagacaccataacaa-cccaaaaatttgagtcaagaaactgactcccgatctcgaatcaaaattgatcggcccaccagactctaaaaacaaatcactg 3824  T
415 aggcacc 421  Q
    |||||||    
3823 aggcacc 3817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 7e-17; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 310 - 427
Target Start/End: Complemental strand, 6718867 - 6718750
Alignment:
310 gccaaagaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaat 409  Q
    |||| |||||||||| | ||||||||||| ||||  ||||||||| |||||||  |||||||||||||| |  |||| |||||  |||||||||||||||    
6718867 gccagagaagacaccataacaagcccaaatatttgagtcaagaaactgactcctcatctcgaatcaaaattgatcgatccaccggactccataaacaaat 6718768  T
410 cactaaggcacccctcaa 427  Q
    || | ||| |||||||||    
6718767 cattgaggtacccctcaa 6718750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 573 - 668
Target Start/End: Original strand, 17834914 - 17835009
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| |||||||||||||||| | ||||||||| |||||| | ||  | |||||||||||||||||| |||||    
17834914 cctagtccacgcgcggccgtactcaaagcagacaaccaataggaggatctggatcacaacttattgggcctagaatgatcaaagaaaggcccatta 17835009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 12612133 - 12612038
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| ||| |||||||| |||||||||||||||| | ||||||||| |||||| | ||  | ||||||||| |||||||| |||||    
12612133 cctagtccacgcgcggccatactcaaagcagacaaccaataggaggctctggatcacaacttattgggcctagaatgatcagagaaaggcccatta 12612038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 356 - 427
Target Start/End: Original strand, 23777664 - 23777735
Alignment:
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||| ||||||||||| ||||||   |||||| |||| ||| ||||||||||| |||||||||||||||||    
23777664 tgacttccgatctcgaagcaaaagcgatcgaccaaccaaacttcataaacaaataactaaggcacccctcaa 23777735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 504 - 572
Target Start/End: Complemental strand, 18855158 - 18855090
Alignment:
504 ctagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaac 572  Q
    ||||| |||||  ||||||||||||||||| ||||||||||| | ||||| |||| |||||||| ||||    
18855158 ctagcgagatccaactcaacactggtttgactgttcaagtcatgtcagctaagcttgttctcactcaac 18855090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 601 - 669
Target Start/End: Original strand, 21687144 - 21687212
Alignment:
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcattag 669  Q
    |||||||||||| ||| | | ||||||| |||||||| || ||||||||||||||||||| | ||||||    
21687144 cagacaaccaatgggaggctatggatcacaacttaatgggctttgaatgatcaaagaaagacccattag 21687212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 12599458 - 12599363
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| ||||||||  || |||||||||||||||| | ||||||||| |||||| | ||  | ||||||||| |||||||| |||||    
12599458 cctagtccacgcgcggccgtactttaagcagacaaccaataggaggctctggatcacaacttattgggcctagaatgatcagagaaaggcccatta 12599363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 25249152 - 25249057
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| |||||||||||||||| | | || |||| |||||| | ||  | ||||||||| |||||||| |||||    
25249152 cctagtccacgcgcggccgtactcaaagcagacaaccaataggaggctttgtatcacaacttattgggcctagaatgatcagagaaaggcccatta 25249057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 561
Target Start/End: Original strand, 21686992 - 21687033
Alignment:
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    |||||||| |||||||||||||||||| |||||||||||||||    
21686992 tcaacactagtttgattgttcaagtca-gccagctcagctcgt 21687033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 427
Target Start/End: Original strand, 46262138 - 46262219
Alignment:
346 gtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||||||| |  ||||||||||||||||||||||  ||| ||||||| |||||  | || |||||  ||||||||||||||    
46262138 gtcaagaaactagctcccgatctcgaatcaaaagtgatcggcccaccagactcccaacaccaatcaaaaaggcacccctcaa 46262219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 466 - 541
Target Start/End: Original strand, 22876037 - 22876112
Alignment:
466 gaccataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaa 541  Q
    ||||||||||||||||||||||||  | ||||||||||| | |||||||||||| |||||||| |||| |||||||    
22876037 gaccataccatgtgacttgtaatagttgacttgaccgaccaacaagatctcacttaacactgggttgactgttcaa 22876112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 592 - 660
Target Start/End: Complemental strand, 28297887 - 28297819
Alignment:
592 tactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaag 660  Q
    |||||||| |||||||||||||||| | ||||||||| |||||||| ||  ||||||||||||||||||    
28297887 tactcaaaacagacaaccaataggaggctctggatcacaacttaatgggccttgaatgatcaaagaaag 28297819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 328 - 427
Target Start/End: Original strand, 28765603 - 28765702
Alignment:
328 acaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||||||||||| ||| ||||||||| |||||| ||||||||||||||||||  || | |||||| | || | ||| |||||| || ||||||||||||    
28765603 acaagcccaaaaacttaagtcaagaaactgactctcgatctcgaatcaaaagtgatcaatccaccagaatctagaaaaaaatcattagggcacccctcaa 28765702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 589 - 660
Target Start/End: Original strand, 22860486 - 22860557
Alignment:
589 ccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaag 660  Q
    ||||||||||| |||||||||||||||| | ||| ||||| |||||||| ||  ||||||||||| ||||||    
22860486 ccgtactcaaagcagacaaccaataggaggctctagatcacaacttaatgggccttgaatgatcagagaaag 22860557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 592 - 668
Target Start/End: Original strand, 38472059 - 38472135
Alignment:
592 tactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||| |||||||||||||||| | ||||||||| |||||||| ||  ||| ||||||| | |||||| |||||    
38472059 tactcaaagcagacaaccaataggaggctctggatcacaacttaatgggccttggatgatcagataaaggcccatta 38472135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 561
Target Start/End: Complemental strand, 28298030 - 28297989
Alignment:
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    ||||||||||||||||||||||||||| |||||| ||||||||    
28298030 tcaacactggtttgattgttcaagtcaagccagc-cagctcgt 28297989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 238 - 274
Target Start/End: Original strand, 9036581 - 9036617
Alignment:
238 cccaattaaacactagaccaatgacttattccaacac 274  Q
    |||||||||||||| || |||||||||||||||||||    
9036581 cccaattaaacactcgaacaatgacttattccaacac 9036617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 360 - 424
Target Start/End: Complemental strand, 12046303 - 12046239
Alignment:
360 tcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    |||||||||||||||||||||  ||| ||||||| ||| |  || |||||||||| |||||||||    
12046303 tcccgatctcgaatcaaaagtgatcggcccaccaaacttccgaatcaaatcactatggcacccct 12046239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 517 - 545
Target Start/End: Original strand, 22860288 - 22860316
Alignment:
517 actcaacactggtttgattgttcaagtca 545  Q
    |||||||||||||||||||||||||||||    
22860288 actcaacactggtttgattgttcaagtca 22860316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 503 - 555
Target Start/End: Original strand, 31678858 - 31678910
Alignment:
503 actagcaagatctcactcaacactggtttgattgttcaagtcaggccagctca 555  Q
    |||| ||||||||||||||||||  |||||| ||||||| |||||||| ||||    
31678858 actatcaagatctcactcaacacgagtttgactgttcaactcaggccaactca 31678910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 41; Significance: 0.00000000000007; HSPs: 11)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 494 - 566
Target Start/End: Original strand, 28313163 - 28313235
Alignment:
494 acttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctca 566  Q
    |||||||| |||||||||||||||||||||| || ||||||||||| ||| | || |||||||||||| ||||    
28313163 acttgaccaactagcaagatctcactcaacattgttttgattgttcgagtaatgctagctcagctcgtcctca 28313235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 573 - 661
Target Start/End: Original strand, 31954597 - 31954685
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaagg 661  Q
    ||||||| |||||| |||||||||||| |||||||||||||||| | ||||||||| |||||| | ||  | ||||||||| |||||||    
31954597 cctagtccacacgcggccgtactcaaagcagacaaccaataggaggctctggatcacaacttattgggcctagaatgatcagagaaagg 31954685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 588 - 668
Target Start/End: Original strand, 25243277 - 25243357
Alignment:
588 gccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| |  ||||||||||||| | ||||||||| |||||||| ||  ||||||||||| |||||||| |||||    
25243277 gccgtactcaaaacgaacaaccaataggaggctctggatcacaacttaatgggccttgaatgatcagagaaaggcccatta 25243357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 328 - 419
Target Start/End: Original strand, 39041275 - 39041366
Alignment:
328 acaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggca 419  Q
    |||||||||| || ||  ||| ||||| ||||||| |||||||||||||||||  ||| ||||||| ||||  ||||||||||| |||||||    
39041275 acaagcccaacaacttgagtctagaaactgactcctgatctcgaatcaaaagtgatcggcccaccagactctgtaaacaaatcattaaggca 39041366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 348 - 414
Target Start/End: Complemental strand, 26474896 - 26474830
Alignment:
348 caagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcacta 414  Q
    ||||||| | |||| ||||||||||||||||||  ||| ||||||| |||||| |||||||||||||    
26474896 caagaaactaactctcgatctcgaatcaaaagtgatcggcccaccaaactccaaaaacaaatcacta 26474830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 356 - 426
Target Start/End: Original strand, 36962644 - 36962714
Alignment:
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctca 426  Q
    ||||||| |||||||||||||||||  ||| ||||||| |||||| || ||||||| ||||| ||||||||    
36962644 tgactcctgatctcgaatcaaaagtaatcggcccaccagactccaaaaccaaatcagtaaggtacccctca 36962714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 476 - 561
Target Start/End: Original strand, 46584809 - 46584894
Alignment:
476 tgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    ||||||| ||||||| |||||| ||  |||| ||||||  |||| |||||||||||||   |||||||||||||| ||||||||||    
46584809 tgtgactcgtaatactttactttactaactaacaagataacactgaacactggtttgacatttcaagtcaggccacctcagctcgt 46584894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 573 - 668
Target Start/End: Original strand, 40137675 - 40137770
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| || ||||||||||||| | ||||||||| |||||| | ||  | ||||||||  |||||||| |||||    
40137675 cctagtccacgcgcggccgtactcaaagcacacaaccaataggaggctctggatcacaacttattgggcctagaatgatcggagaaaggcccatta 40137770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 346 - 424
Target Start/End: Complemental strand, 32057175 - 32057097
Alignment:
346 gtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    ||||||||| ||||| |||||||| ||||||||||  ||| || || | ||| ||||||||||||| ||||||| ||||    
32057175 gtcaagaaactgacttccgatctcaaatcaaaagtgatcgtccaactaaacttcataaacaaatcattaaggcaaccct 32057097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 518 - 559
Target Start/End: Original strand, 28313369 - 28313410
Alignment:
518 ctcaacactggtttgattgttcaagtcaggccagctcagctc 559  Q
    ||||||| |||||||| ||||||||||| |||||||||||||    
28313369 ctcaacattggtttgactgttcaagtcatgccagctcagctc 28313410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 519 - 555
Target Start/End: Original strand, 46585091 - 46585127
Alignment:
519 tcaacactggtttgattgttcaagtcaggccagctca 555  Q
    ||||||||||||||| |||||||||||| ||||||||    
46585091 tcaacactggtttgactgttcaagtcagaccagctca 46585127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 38; Significance: 0.000000000004; HSPs: 10)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 358 - 427
Target Start/End: Original strand, 24991946 - 24992015
Alignment:
358 actcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    |||||| |||||||||||||||  |||| ||||||||| |||| |||||||||||||||| ||| |||||    
24991946 actccctatctcgaatcaaaagcggtcggcccaccataatccaaaaacaaatcactaaggtacctctcaa 24992015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 360 - 424
Target Start/End: Original strand, 24099360 - 24099424
Alignment:
360 tcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccct 424  Q
    ||||||| |||||||||||||  ||| ||||||| |||| |||||||||||| ||||||||||||    
24099360 tcccgatatcgaatcaaaagtgatcggcccaccagactctataaacaaatcattaaggcacccct 24099424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 14486642 - 14486547
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| ||||||||||||  || |||||||||||| | ||||||||| |||||||| ||  | ||||||||| |||||||| |||||    
14486642 cctagtccacgcgcggccgtactcaaaggaggcaaccaataggaggctctggatcacaacttaatgggcctagaatgatcagagaaaggcccatta 14486547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 4 - 79
Target Start/End: Complemental strand, 27044100 - 27044025
Alignment:
4 aacactaacaacattaatacaaacatcacttaaattgagaattaccaccaataccaataagaaacctaactaccaa 79  Q
    |||| ||| |||| |||| |||||| ||| ||||||||||  |||||||||  |||||||||||||||||||||||    
27044100 aacaataataacagtaattcaaacaccacctaaattgagagctaccaccaaccccaataagaaacctaactaccaa 27044025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 592 - 668
Target Start/End: Original strand, 17471848 - 17471924
Alignment:
592 tactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||| || ||||||||||||| | ||||||||| |||||||| ||  | ||||||||| |||||||| |||||    
17471848 tactcaaagcaaacaaccaataggaggctctggatcacaacttaatgggcctagaatgatcagagaaaggcccatta 17471924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 362 - 426
Target Start/End: Complemental strand, 24712684 - 24712620
Alignment:
362 ccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctca 426  Q
    |||||||||||| |||| |   || |||||||||||||| |||||||||| ||||||||||||||    
24712684 ccgatctcgaataaaaaatgaccggcccaccatactccagaaacaaatcagtaaggcacccctca 24712620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 315 - 422
Target Start/End: Original strand, 19133732 - 19133839
Alignment:
315 agaagacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcacta 414  Q
    |||||||||| | ||||||| ||||||||  | ||| ||| ||||| || | ||||||||||||||  || |||||||| | |  | |||||||||||||    
19133732 agaagacaccgtaacaagccaaaaaatttgagccaataaactgacttccaaactcgaatcaaaagtgatctacccaccaaatttgagaaacaaatcacta 19133831  T
415 aggcaccc 422  Q
    ||||||||    
19133832 aggcaccc 19133839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 573 - 662
Target Start/End: Original strand, 17441584 - 17441673
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggc 662  Q
    ||||||| || ||| ||| |||||||| ||||||||||| |||| | ||| ||||| |||||||| ||  | ||||||||| ||||||||    
17441584 cctagtccacgcgcggccttactcaaagcagacaaccaaaaggaggctctagatcacaacttaatgggcctagaatgatcagagaaaggc 17441673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 591 - 668
Target Start/End: Complemental strand, 20127843 - 20127766
Alignment:
591 gtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||||| ||||||||| | |||| | |||||||||||||||||| ||  | ||||||| | |||||||| |||||    
20127843 gtactcaaagcagacaaccgaaaggaggctctggatcataacttaatgggcctagaatgattagagaaaggcccatta 20127766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 356 - 428
Target Start/End: Complemental strand, 30127314 - 30127242
Alignment:
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaat 428  Q
    ||||||||||||||||||||||||   ||| | ||||| |||||  |||||||||| ||  ||||||||||||    
30127314 tgactcccgatctcgaatcaaaagcgatcggctcaccagactcccgaaacaaatcaatagagcacccctcaat 30127242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.00000000002; HSPs: 6)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 514 - 578
Target Start/End: Complemental strand, 24526476 - 24526412
Alignment:
514 ctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacgcaaccctagt 578  Q
    |||||||||||||||||||| ||||||||||| | ||||| | ||||||||||| |||| |||||    
24526476 ctcactcaacactggtttgactgttcaagtcatgtcagcttaactcgttctcactcaacactagt 24526412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 356 - 397
Target Start/End: Original strand, 17657031 - 17657072
Alignment:
356 tgactcccgatctcgaatcaaaagtcgtcgacccaccatact 397  Q
    |||||||||||||||||||||||||  |||||||||||||||    
17657031 tgactcccgatctcgaatcaaaagtgatcgacccaccatact 17657072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 387 - 426
Target Start/End: Original strand, 17819864 - 17819903
Alignment:
387 cccaccatactccataaacaaatcactaaggcacccctca 426  Q
    ||||||| ||||||||||||||||| ||||||||||||||    
17819864 cccaccagactccataaacaaatcagtaaggcacccctca 17819903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 518 - 561
Target Start/End: Original strand, 26568170 - 26568213
Alignment:
518 ctcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    |||||||||||||||| |||| |||||| |||||||||||||||    
26568170 ctcaacactggtttgactgtttaagtcatgccagctcagctcgt 26568213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 319 - 427
Target Start/End: Complemental strand, 12883678 - 12883571
Alignment:
319 gacacccttacaagcccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggc 418  Q
    |||||| | |||| |||||||| ||| |||| || | |||||  ||||||||||||||| |   |||  |||||| ||||||||||||||| | ||||||    
12883678 gacaccataacaaacccaaaaacttaagtcacgacactgactttcgatctcgaatcaaa-gcgatcggtccaccagactccataaacaaattattaaggc 12883580  T
419 acccctcaa 427  Q
    |||||||||    
12883579 acccctcaa 12883571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 465 - 572
Target Start/End: Complemental strand, 24526624 - 24526516
Alignment:
465 cgaccataccatgtgacttgtaatacctt-acttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttc 563  Q
    ||||||| | ||||| ||||||||| ||| || |||| | |||||||||||  ||| | ||| ||||||| ||||||||||| | ||||| ||||||| |    
24526624 cgaccatgctatgtggcttgtaatatcttgacctgactggctagcaagatccaacttagcaccggtttgactgttcaagtcatgtcagcttagctcgtcc 24526525  T
564 tcacgcaac 572  Q
    |||| ||||    
24526524 tcactcaac 24526516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.00000000002; HSPs: 15)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 573 - 661
Target Start/End: Original strand, 37349595 - 37349683
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaagg 661  Q
    ||||||| || ||| |||||||||||| ||||||||||||| || | ||||||||| |||||| | ||| | ||||||||| |||||||    
37349595 cctagtccacgcgcggccgtactcaaagcagacaaccaatatgaggctctggatcacaacttattgggtctagaatgatcagagaaagg 37349683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 573 - 668
Target Start/End: Complemental strand, 4109178 - 4109083
Alignment:
573 cctagtctacacgcagccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    ||||||| || ||| |||||||||||| |||||||||||||||| | ||||||||| |||||| | ||  |  |||||||| |||||||| |||||    
4109178 cctagtccacgcgcggccgtactcaaagcagacaaccaataggaggctctggatcacaacttattgggcctaaaatgatcagagaaaggcccatta 4109083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 601 - 668
Target Start/End: Complemental strand, 45108007 - 45107940
Alignment:
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| ||| | ||||||||| |||||||| || |||||||||||| |||||||| |||||    
45108007 cagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgatcagagaaaggcccatta 45107940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 601 - 668
Target Start/End: Complemental strand, 45109726 - 45109659
Alignment:
601 cagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaaggcgcatta 668  Q
    |||||||||||| ||| | ||||||||| |||||||| || |||||||||||| |||||||| |||||    
45109726 cagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgatcagagaaaggcccatta 45109659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 476 - 566
Target Start/End: Original strand, 5168942 - 5169032
Alignment:
476 tgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctca 566  Q
    ||||||||||||||| ||| |||||  |||||||||| |||| |||||| |||||||| | || |||| |||||| |||| ||||| ||||    
5168942 tgtgacttgtaatactttatttgactaactagcaagacctcattcaacaatggtttgactatttaagttaggccaactcaactcgtcctca 5169032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 590 - 660
Target Start/End: Original strand, 5169271 - 5169341
Alignment:
590 cgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatcaaagaaag 660  Q
    |||||||||| |||||||||||| ||| | ||||||||| |||||||| || |||||||||| | ||||||    
5169271 cgtactcaaaacagacaaccaatgggaggctctggatcacaacttaatgggctttgaatgattagagaaag 5169341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 588 - 653
Target Start/End: Original strand, 13968774 - 13968839
Alignment:
588 gccgtactcaaaccagacaaccaataggatgttctggatcataacttaataggttttgaatgatca 653  Q
    |||||||||||| || ||||||||||||| | ||||||||| |||||||| ||  |||||||||||    
13968774 gccgtactcaaaacatacaaccaataggaggctctggatcacaacttaatgggccttgaatgatca 13968839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 359 - 427
Target Start/End: Original strand, 4162052 - 4162119
Alignment:
359 ctcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa 427  Q
    ||||||||||||||||||||||  ||| ||||||| |||||  | |||||||||| |||||||||||||    
4162052 ctcccgatctcgaatcaaaagtgatcggcccaccagactcccaacacaaatcact-aggcacccctcaa 4162119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 519 - 566
Target Start/End: Original strand, 5169077 - 5169124
Alignment:
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgttctca 566  Q
    |||||||||||||||| ||||||||||| |||||||| ||||| ||||    
5169077 tcaacactggtttgatcgttcaagtcagaccagctcaactcgtcctca 5169124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 519 - 561
Target Start/End: Complemental strand, 45110043 - 45110001
Alignment:
519 tcaacactggtttgattgttcaagtcaggccagctcagctcgt 561  Q
    ||||||||| ||||||||||||| |||||||| ||||||||||    
45110043 tcaacactgatttgattgttcaaatcaggccaactcagctcgt 45110001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 356 - 393
Target Start/End: Complemental strand, 7874343 - 7874306
Alignment:
356 tgactcccgatctcgaatcaaaagtcgtcgacccacca 393  Q
    |||||||||||||||||||||||||  |||||||||||    
7874343 tgactcccgatctcgaatcaaaagtgatcgacccacca 7874306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 504 - 545
Target Start/End: Complemental strand, 25057150 - 25057109
Alignment:
504 ctagcaagatctcactcaacactggtttgattgttcaagtca 545  Q
    ||||||||||||||||||||||| | |||| |||||||||||    
25057150 ctagcaagatctcactcaacactagcttgactgttcaagtca 25057109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 469 - 578
Target Start/End: Original strand, 32225801 - 32225910
Alignment:
469 cataccatgtgacttgtaataccttacttgaccgactagcaagatctcactcaacactggtttgattgttcaagtcaggccagctcagctcgttctcacg 568  Q
    ||||| ||||||||| |||||  |  ||||||||||||| ||||||| ||||||| | || ||||||||| |||| | || ||||||| | || |||||     
32225801 catactatgtgacttataatagttggcttgaccgactagtaagatcttactcaactccgggttgattgtttaagttatgcaagctcagttagtcctcact 32225900  T
569 caaccctagt 578  Q
    |||| |||||    
32225901 caacactagt 32225910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 519 - 552
Target Start/End: Complemental strand, 45108240 - 45108207
Alignment:
519 tcaacactggtttgattgttcaagtcaggccagc 552  Q
    ||||||||||||||||||||||| ||||||||||    
45108240 tcaacactggtttgattgttcaaatcaggccagc 45108207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 29; E-Value: 0.000001
Query Start/End: Original strand, 395 - 427
Target Start/End: Original strand, 19948013 - 19948045
Alignment:
395 actccataaacaaatcactaaggcacccctcaa 427  Q
    |||||| ||||||||||||||||||||||||||    
19948013 actccagaaacaaatcactaaggcacccctcaa 19948045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0572 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0572
Description:

Target: scaffold0572; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 435
Target Start/End: Original strand, 6262 - 6364
Alignment:
334 ccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa-tcccg 432  Q
    ||||||| ||| ||||||||| |||||  ||  ||||||||||| ||  ||| | ||||| |||| | ||||||||||||||| |||||||||| |||||    
6262 ccaaaaacttaagtcaagaaactgactttcgtcctcgaatcaaatgtgatcggctcaccagactctagaaacaaatcactaagtcacccctcaactcccg 6361  T
433 gac 435  Q
    |||    
6362 gac 6364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0127 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0127
Description:

Target: scaffold0127; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 435
Target Start/End: Complemental strand, 31330 - 31228
Alignment:
334 ccaaaaatttaggtcaagaaagtgactcccgatctcgaatcaaaagtcgtcgacccaccatactccataaacaaatcactaaggcacccctcaa-tcccg 432  Q
    ||||||| ||| ||||||||| |||||  ||  ||||||||||| ||  ||| | ||||| |||| | ||||||||||||||| |||||||||| |||||    
31330 ccaaaaacttaagtcaagaaactgactttcgtcctcgaatcaaatgtgatcggctcaccagactctagaaacaaatcactaagtcacccctcaactcccg 31231  T
433 gac 435  Q
    |||    
31230 gac 31228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 95101 times since January 2019
Visitors: 2228