View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9281-LTR4-TNT-insertion-1 (Length: 189)

Name: F9281-LTR4-TNT-insertion-1
Description: F9281-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9281-LTR4-TNT-insertion-1
F9281-LTR4-TNT-insertion-1
[»] chr3 (2 HSPs)
chr3 (9-180)||(39815715-39815886)
chr3 (13-97)||(39813161-39813245)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 9 - 180
Target Start/End: Complemental strand, 39815886 - 39815715
Alignment:
9 ggagtgagtaacataatgagtcacataacgtggagaaaagcataggatatggcacgccacgtgtgtagagtaatgctcaagttcacacgggtttagctga 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39815886 ggagtgagtaacataatgagtcacataacgtggagaaaagcataggatatggcacgccacgtgtgtagagtaatgctcaagttcacacgggtttagctga 39815787  T
109 ataacgtcaagcatggtacaatctttttaggtctagatcgtatctaataggacttaggctctgaaacaattg 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39815786 ataacgtcaagcatggtacaatctttttaggtctagatcgtatctaataggacttaggctctgaaacaattg 39815715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 13 - 97
Target Start/End: Complemental strand, 39813245 - 39813161
Alignment:
13 tgagtaacataatgagtcacataacgtggagaaaagcataggatatggcacgccacgtgtgtagagtaatgctcaagttcacacg 97  Q
    |||||||||||| |||||  ||||| ||||||||| || |||||||| || | |||||||||||||||| |||||||||| ||||    
39813245 tgagtaacataacgagtcgtataacatggagaaaaacaaaggatatgacatgtcacgtgtgtagagtaacgctcaagttcgcacg 39813161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC