View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9282-LTR4-TNT-insertion-1 (Length: 504)

Name: F9282-LTR4-TNT-insertion-1
Description: F9282-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9282-LTR4-TNT-insertion-1
F9282-LTR4-TNT-insertion-1
[»] chr1 (2 HSPs)
chr1 (10-494)||(47328327-47328811)
chr1 (256-391)||(2408504-2408635)
[»] chr5 (1 HSPs)
chr5 (208-392)||(37212764-37212943)
[»] chr4 (1 HSPs)
chr4 (306-392)||(45163635-45163720)
[»] scaffold0008 (1 HSPs)
scaffold0008 (208-392)||(89802-89981)
[»] chr7 (1 HSPs)
chr7 (304-393)||(3053702-3053790)


Alignment Details
Target: chr1 (Bit Score: 458; Significance: 0; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 458; E-Value: 0
Query Start/End: Original strand, 10 - 494
Target Start/End: Complemental strand, 47328811 - 47328327
Alignment:
10 aggcatggagatcatattgccaaggtcttacnnnnnnnnnggtggcaaacatccataagagtaacatcacaccaaactttgcgatcatagagatcatata 109  Q
    |||||||||||||||||||||||||||||||         ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47328811 aggcatggagatcatattgccaaggtcttacaaaaaaaaaggtggcaaacatccataagagtaacatcacaccaaactttgcgatcatagagatcatata 47328712  T
110 gcttttgtcgatggaaaagatacaagccaattttgagatactattactccattccctttgttgttgacccgttgtagcccttatgaatgtgggtggtcca 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47328711 gcttttgtcgatggaaaagatacaagccaattttgagatactattactccattccctttgttgttgacccgttgtagcccttatgaatgtgggtggtcca 47328612  T
210 actttaatttctctactatatagtttgacacaacatttttacaactttccactaacgatgattacatcacaaaaaccttgcctttgcaaagtgtagcgag 309  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47328611 actttaatttctctactatatagtttgacacaacatttttacaactttccactaacgatgattacatcacaaaaaccttgcctttgcaaagtgtagcgag 47328512  T
310 tgtggaagatatcgtgtcttaacgatggttcttctttgatagattgttgagcgtaagctacttctaactaccaatgattcaccatagttcgtaggaacgt 409  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47328511 tgtggaagatatcgtgtcttaacgatggttcttctttgatagattgttgagcgtaagctacttctaactaccaatgattcaccatagttcgtaggaacgt 47328412  T
410 aatcgttaacataaattggttcttccatttcatcttcttcttctttaacaaaaatataggggatatatgatcaccttgccaaatt 494  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47328411 aatcgttaacataaattggttcttccatttcatcttcttcttctttaacaaaaatataggggatatatgatcaccttgccaaatt 47328327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 256 - 391
Target Start/End: Original strand, 2408504 - 2408635
Alignment:
256 ttccactaacgatgattacatcacaaaaaccttgcctttgcaaagtgtagcgagtgtggaagatatcgtgtcttaacgatggttcttctttgatagattg 355  Q
    |||||||| | ||||| ||||||||||  | ||||||| || | ||| |||||||||||||||||| |||||||| | |||||||||||||||   ||||    
2408504 ttccactatcaatgatgacatcacaaa--ctttgcctt-gcgaggtgcagcgagtgtggaagatattgtgtcttagccatggttcttctttga-ctattg 2408599  T
356 ttgagcgtaagctacttctaactaccaatgattcac 391  Q
    | | | ||||||| ||||||||||| | ||||||||    
2408600 tggtgtgtaagcttcttctaactactagtgattcac 2408635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 5e-17; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 208 - 392
Target Start/End: Complemental strand, 37212943 - 37212764
Alignment:
208 caactttaatttctctactatatagtttgacacaacatttttacaactttccactaacgatgattacatcacaaaaaccttgcctttgcaaagtgtagcg 307  Q
    |||||| ||||| || || |||||||| || |||||||| | ||| ||| |||||| | ||||| ||||||||||  | ||||||| || | ||| ||||    
37212943 caacttcaatttttccaccatatagttggatacaacattctcacagctt-ccactatcaatgatgacatcacaaa--ctttgcctt-gcgaggtgcagcg 37212848  T
308 agtgtggaagatatcgtgtcttaacgatggttcttctttgatagattgttgagcgtaagctacttctaactaccaatgattcacc 392  Q
    |||||||||||||| |||||||| | |||||||||||||||  | |||| | | ||||||| ||||||||||||| |||||||||    
37212847 agtgtggaagatattgtgtcttagccatggttcttctttgactg-ttgtggtgtgtaagcttcttctaactaccagtgattcacc 37212764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 306 - 392
Target Start/End: Complemental strand, 45163720 - 45163635
Alignment:
306 cgagtgtggaagatatcgtgtcttaacgatggttcttctttgatagattgttgagcgtaagctacttctaactaccaatgattcacc 392  Q
    |||||||||||||||| |||||||| | |||||||||||||||  | |||| | | ||||||| ||||||||||||| |||||||||    
45163720 cgagtgtggaagatattgtgtcttagccatggttcttctttgactg-ttgtggtgtgtaagcttcttctaactaccagtgattcacc 45163635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0008 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: scaffold0008
Description:

Target: scaffold0008; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 208 - 392
Target Start/End: Complemental strand, 89981 - 89802
Alignment:
208 caactttaatttctctactatatagtttgacacaacatttttacaactttccactaacgatgattacatcacaaaaaccttgcctttgcaaagtgtagcg 307  Q
    |||||| ||||| || || |||||||| || |||||||| | ||| ||| |||||| | ||||| ||||||||||  | ||||||| || | ||| | ||    
89981 caacttcaatttttccaccatatagttggatacaacattctcacagctt-ccactatcaatgatgacatcacaaa--ctttgcctt-gcgaggtgcatcg 89886  T
308 agtgtggaagatatcgtgtcttaacgatggttcttctttgatagattgttgagcgtaagctacttctaactaccaatgattcacc 392  Q
    |||||||||||||| |||||||| | |||||||||||||||  | |||| | | | ||||| ||||||||||||| |||||||||    
89885 agtgtggaagatattgtgtcttagccatggttcttctttgactg-ttgtggtgtggaagcttcttctaactaccagtgattcacc 89802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 304 - 393
Target Start/End: Complemental strand, 3053790 - 3053702
Alignment:
304 agcgagtgtggaagatatcgtgtcttaacgatggttcttctttgatagattgttgagcgtaagctacttctaactaccaatgattcacca 393  Q
    |||||||||||||||||| |||||||| | |||||||||||||||  | |||| | | ||||||| ||||||||||  | ||||||||||    
3053790 agcgagtgtggaagatattgtgtcttagccatggttcttctttgactg-ttgtggtgtgtaagcttcttctaactattagtgattcacca 3053702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 98172 times since January 2019
Visitors: 2269